Description :
From Genome Similarity Track
Location :
Scaffold_2:831009- 837724
Transcript NameFunction/comments
Phyca_LT153413027Hypothetical protein
Phyca_LT1534538799pro-apoptotic serine protease nma111-like protein

Sequence
6715 bases(100 bases per row)
aaagccgatgtgggaataccacgcatattgcttagagcttgggcttcataccagtagcttagaccgatgtcgtagtacctttccgcggctgcctcgtcac
agccatccgaaccttcgttaccgttcttgccggaaagtaaaatagcagcctcgtatgccttccttcctgctctaatgaaatccacccagctggatccttc
gctggaaaagttatcgggcgacaagtagaaagcaaagcaatggatatcaccgatcacctttaatgcttctatagatccagagagtggtgatgttgatggc
agccctttcatcatacgtgatgcctctttcagattaacagcagcgttgccgtataacccctcagcgcacaaatatttagcttgctggaaaagtaactcag
agtaaatcatagtcgcaacagtcacgtctggttcaccatcaaccaactctccagtaacaaccggcttgatacggtccaaagcgtcttcgaataacagcaa
cgagccttcaattcgggcgagttcacagcgaacacaccagccgtcttcacccaattcgatggccttcaaatatgatctctgcgctgatacttgcttatcg
aagttctgataaatatgtgccagagcaacccagtaacgagcattcatcggatcattgcgcagcactaagtgcatcttagccactgcggtctcgtcatttt
gccccacaaggtgctgtaccaatcgaagaagggcccatgtcggtgcagtctcttgatcctctgtcacccgctcccaaagcttcacgttcgcctcatactt
accctgcacttcatacaggtcgctgagagccataccggccaactcgtctacgacagaaatcgaaagagccttcagaaagcatttttcagcgcgcacaata
tcctttgcgacttcttgataccattttcccaaccacgagaagatctcggcgtcagatggcgtcagctttgcagcttgtagtaaatggccaaagcatccag
tttttgaagtttggtgagtaccacctaagtgccagtatacaatcgccaagcgcttcagcgttcgtcccttggcgataacatcacttgacaaaagtttgcc
cacatttgcctctaaaagcgcttgagcctcctccagaccaccgatctgaaattgaagccatcctcgtgtgcactccaggacggcactcgtgtttcggata
ctttagctcagtcactccaggcgtcgatatggcactcatggcgtccgcaggctgtgactttctcaacaaaagctctgctgcagcaatcgtcgcctgcacc
gccaaagtagcatcaccactccccatgacactgcggtagagctccaatgcttttccgcttcgcctgagtattcgtgtgcagttgccgtcataaagtccat
cttaggttccgagtatctatgcacagaacatcagagttagacaacattattaattcttcgacgatacacagcatccttacaactctggaagcgggcctcc
cgaaccgagtaacagcatcttgtcagctacgactttctttgctaaggttaaccgatttagacaaccttccacgtcgcgtgacgcaagtgcgattgacgca
agctcaacttgaacgcgaatgcaaagagaacactcttgaaaagatgaagaggagtaccctgcaagcgcttcaacaaagatttctcgtgcctggcacatta
acagggaaacacatggtcagcatccgccttcttttgcagtgccacgccaacctacctgaatgctgtcccccgctcgcaaactctcggtagcttggaacac
aagagccataggactcttagggtgacggatagacagctgagctccaatctctgatgacttccctgattcaattgctgtatctcaacccacggttagtatt
acacgtgaacagaagtaggtacagccttaatagaacgtacgtgagtcctggtcttcagatcggagaagcaaaaactctgctgggatctttgcttcaggaa
accacccaacgattgacactgccagcgaatccacagtcttaagtagagcagatctcgttttcgactttttcaagacatccagatggaatcgcataaagaa
cgcaatcgcaacgtccactttcactcggatcgcgccgatctcttcactctgaactgtccagtccgtacgagctgcaacggcaaaaaactgcttcgatata
tctgccatagagtagctgcctgagcattcagataaactaaagcctgggcgctaaatcacgaacacagtattctttaaggatttcggcaatatcctgaaaa
tcaaagatattccagttctgtacctgaagcagatcaatcaagtccagccatatacgtaacggatctggaagttcctcattgggggtcttctcgagtgaaa
gttgagctaaatctccatcctgttcgcccactaatgagtaccacgaatcaaaagcctgcgcgagccagaagaaataagtacacgtggtttgaaactacat
catgtggcaccacacagaccttcgtcagcatcttcagctccatcgcagtggctgccacctcagccacccacttctggcatttcttcagcttctttcccct
acaatccgccaaaaccattagtatgagggatttacagactataagccccccatctgtacctcaaattgatatccacaagcttctgcagcggttccaactt
gctcttcacgtcccttttggccccgaataggtccacaagatactgcaaaaatcttttagtcagtttacagccataatagccatctatatccttttcccca
ccttccaaggcgctggaagttcaggcttcaggtctgcagcacgacggtaagcgtcttcacaatcttcccactgcacaatagtcaacaatatgagcattat
agagcgaagagtgaaacgcagtagttagcccaaatacgcacctcctgcaggtggaaactagccagccccacgcacataaaggcctggaaattgtttgggt
caaactgcgtcacacggcgacccgcgtcctgcgcctcctggtagcgctcagccttgagcgccgccgccgcgtccagcagcatcttttcagcatcgccgcc
gacattttgagtcgatgcggaatgaaaatgggcactttattttgtctttatttttgggtatatttgcttaaaattagataacagtttcataaattgagcc
agttgaacacaagcttgatcattccaacggggaccaatgtggaaggccggagcgcgtgcggcttcgacggcgcggcgctcgttcgcgtgcccattaacac
gggctagggccagtaatgcgcggttgtctcgacgcccgcgtgcgctacagatgctggagcgaccgttctcctcctcctcctcttcatctcccccaagtac
gtggcaatcggagcgattgttgttcgattgaatttgacagttttatgtatttgatagctacgcagaatgcgcaaatggcggtggcagcgctggctgcagc
gggagttggttatctatttgtgacaacggagcgtcagagtaagcaggagaagcaacagcgagaactggagatagaacgcgaacgcaagctcagcgaccgt
ttggcagcagaacttgtggcagccgaagcgaaccagaacaaactggactggaaagccacgctggaacgtgtggtaccggctatcgtgagcttgaagctga
attcgccaaaggtgagggaaaattctgctgctgacgttaataattgtactgacatggttgatttgggtcttatagttttttgacacggagtcaccgggca
atggatccgcgacgggatttgtggttgacgcggagaagggcatcattctgacgaaccgccacgttgtgggacctggcccgattgtacggtggtaaaaggt
tttggtagctacggtggcggatattgacatagtttgtgtgtgtaggatgcagaggctgtcttccagaataatgaagaagttcgggtgatccccatttatc
gcgatccggttcatgactttgggtttttccaattcaatccagcggtaagtatgtattgtaatgtggatgttatcctgtgtaattgaagtgaggtccttac
tggtagtttgctttaacaggacgtgaagcacatgccagtgtcatcgctgcatctagagccggaaaaagccaccgttggaacggacatccgtgttgtgggt
aacgatgctgcagaaaaacttgccattgccagtggcacgttggcgcgtttggatcgtgacgcccccaactacgggtacaatagttacaacgactttaaca
cgttttactaccaggcatcttcaggaacgactggaggctcctcgggttcgccagtgctcaaccatgatggcgatgcgatcgctcttaatgccggtggcaa
gatcggcacgtcggcatcgttttacctacccttagaccgagttaagcgtgcattcgacttaattcgagaaggcaaagacgtgccgcgcggcactatccag
acgatcttccattacaagcctttcgacgaggtccgtcgtttaggggtagaccctgctactgaaaggcttgttcgctcctcttttccactggaaacaggta
tgttgacggtggccgagaccatccctggcggcccttcaagcagcaagctccagcctggcgatgtgctggtgcgagttaatggagagttgatcacgcggtt
tgttccgctagaagcgattctcgatgacaacgtcgggagtgaggtaagaatttaccattggatggatatgctatagactacatggctgacaagtgtcttt
ttcgtcgttttaccttagattgaacttcaaatcgaacgttcaggggagctcgttacgcataaggtgccagtgcaagatttgcactcggtcaccccatcgc
gtttcgttgagattggaggtgctgtgattaacccgctttcgtatcagcaagcacgcaaccatgcgatgagcccaggagcgccttacgttgcagaccccgg
ctacttccttcaacgttcgcgtattggccgcggtgcaatcattcactcggtcaatggtattaagacacctgaccttgagaccctcaagaactacctgaaa
cagtgcaaggaccgtgatcgtatcgtggtcaagttctctaagttgacggataagtcggagaaggttgaagttgttcatgtggatcgtaggtggttcccat
tctgcgagtacgtgcgcgacgacaagcttgggacgtggcactgcgagcatttcgccccgcctagtgcagccagtaatgcagacgaagatgacacgatcaa
ggcctctcctcaggatgagtcgattggttcaacaactactctgcccggaaagaaccccgtggagaacaagcttgcccggtcgttggtgactgtggatttt
gacagaccgttcagtgtgaatagtttgtcaacatcgaactaccggggtactgggcttgtaatcgatgcgacaaaggggctcgtggtagtagatcgcaata
ccgtgacagactcgatgggtgatgccatggtgactttcgcaagcaccattatggtccccgctcatgtggtattcgttcaccctgtacataacttcgcgat
tgtgcagtatgacccgaagctcattgggtcgacgcctattgaaagctgccaagtggcttcaaagccattggtaccgtccgatccagtatggctcgttgga
ctgatgagtagcgtgggccgcagtggtcactccgatcttgtgtcgcgtgagacaattgtttccggtgtcaaatggatcggcttacccatgcccaaccctc
ctcgatatcaggaacataatctggagatggtctctctgcaggatgttgttggcactgaaggtggggttgtttgcagcgacaagggagaggtgagcgcctt
ctgggcttctttttcgttccagcagcagcgacgtagttcaaaggtggaaagccaatttaaccgcggcatccctatggatctgatcatggaaagcgcggca
cctcttatgcgtggcgtgacacccaaaatctacgatctaggtgttgattttgagcacttgagcttggcgaaggctcgggaacttgggcttggccaagcac
tggcggagattctggagaaggatgctcccgatcgccgaaccattttaagtgttgctcgacgctggggtggtacagaggcccaggacgtgcttaagaatgg
tgatatcttggtggctgtggatggtaaaattgtgacgagctttcgcgaggttgaacgctgcacacagaagccggaggtgcagctcacgattgtgcgcgat
ggtcgtgagatgcaactggatgtgaagactcttttcatggaacggacggagatcaatcgcatcgtgttctggcaaggtttgttgcttcaagcgccacctc
tgtctgtatcggctcagcggagcatatcgttggacgatgggatttatgtgtcctgtcggtactcaggatccccggcagctcgctatggaccaccaccgac
gagtcgcatcaaagaaattgacggtatcaaaattacaagtatcgacgagttcttgagtgtcgtcactgctaaatcgaccaacgattcggtacgcattaag
tacacggacctcagtggcaaggagcgcctcagcacccttaagctcgagcccaagtactggcctaccagcgagttggtgaatgaaagcggtgagtggcgtc
gacaccaacactaaa