Description :
From Genome Similarity Track
Location :
Scaffold_150:8310- 18839
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_150-snap-gene-0.16Tetratricopeptide repeat protein
Pytul_var.sporangiiferummaker-pug3_contig_150-snap-gene-0.17Histone-lysine N-methyltransferase
Pytul_var.sporangiiferummaker-pug3_contig_150-fgenesh-gene-0.10Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_150-snap-gene-0.18Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_150-fgenesh-gene-0.5Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_150-snap-gene-0.26Oxidation resistance protein (ISS)

Sequence
10529 bases(100 bases per row)
CTACCTCGAGAGTGTCGATGTGAGTCCGATGAACACTGCCGCGTGGTTCGTGATCGGCTCCATGAGCATGCGCCTGGAGAAGTGGGAGCTCGCGCTGCGT
GCATTCACGCGCGTTGTGCAACTTGATCCGGAGAACGGCGAGGCCTGGGGCAACATCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGAGGCGTTCTCGGTGTTCCAGGAGGCGCTCAAGCAGAAGCGCCACATGTGGCAGATGTGGGAGAACTACGCCGTGTGCGCCATGGAGACCGA
CAAGTACGGCGAGGCGATTTACGCAACGCACCAGCTACTCGACCTGCGCAGCAAACACAACCGCCCCGTNNNNNNNNNNAAGCTCGTCGAGGACCTCCAG
GTCACGGACGAGAGTGAGGAAGCCGTGCACGCTCTTGGTGACGATGGAGAAGACGATGACGACCTGGCGGACTTCGACGANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGGCGACAAGACGCCGATGCGCTCAAACACGAACTTCAAGAAGCAGCTCGCGATGCTCTTCGGGCGCAT
CACGTCGATCACGNNNNNNNNNNCAACGCCAAGATCTGGCAGATCTACGCGCACTTCAACGATGGTCTCGGACGCAAGGAGAAGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGGCCGTGCGGCTCTCGGAGGACTACATCGC
GCAGGGCACGAAGAAGGCTCTGTACTCTTGCCGGCTGTACATCCGCGGTGTGCTCAAGAAGGCGCAGGTGGACTACGCGGCGCTCGAGGAAGTGCAGGTG
CTCGCGGCCACGCTCGACCGCGTCAACCAGCTCGAGACGCAGCTGTAGATGAGAGCAGGTAGCGTATATAAAGATACATAATGCCAGGTACATTCAGTAG
CTGCTTCCTGTGCCATGCGATCCCCTACCGACTGCAGTGCGCGCATGTACAATGCCGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCGCATCAAAGGTCCTGCATGCGTGTCTCTTCTTTTCTACCAATCATATTCAAATATAGCTTATTTCATCCAATGG
TAAGTCATAGTTTATGGCGCGAGCTCGCTTTTGGTTTTCAAAAACTCGCAATAGTGAGCTGCTGGTGGCCGCAGACACTGGCAGTGGACTCATTGACGAG
ACTCAAAGCCACACGGAGAAGCGCGATGGTTCAACGCCGCAGCAGCTCGTGGCTCAGCATCTCCGCGTCCCCATCCACTGCCAGCACTGCCNNNNNNNNN
NNCCATCAAGCGCTTCAGCATGCGCACGGCCGAGGCGCTGCTCAAGGCAGCGAACGCGGCCAAGCACGTCGACAGCCAGGACGAGCTCTACGCTGCTCTC
GACGCCAAGGAGCATGGCATCGCGGCGGATACAGATGGCGATGATAAAGGCGAAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGC
GCGGAGAGTGAGGAGAACAGTGTGTTCACGTCCGACACGCAGCAGTTCCTGGACGCGCTCAAGAGGGACGCGCTGCGCAAATGGATCCCGCAGCCCTTTG
AACTGCCATTTTCCAAGTCCGAGATCAAGAACTTAGAGGTATGCTAGCACTAAGGGTTCAATGAGTGAATGGCCATGGCGTTCTATTGTATCTATGTATG
CGCTTGTGTGTCCATGTAGGCGCGCAAGTTGGAGTATCGCCCTCCTCACTATGGGAAGATCAGCAAGTGCGTGTTTGTATCGAAACCCGCGATGCCGAAC
GCAGAGCTCCCGGTCCATAAATGCAACTGCTTTGCCGAGACCAAAGTGGTGTCCACGAAGCGAGAGACGCAGATCGCGAGCACGAAGCTGCTTAAGGAGA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCGGCAAAGAGCCCCAGCAAGAAGGCGCCGAGTGCAGAGGGAAG
CAGCAACAACAACACCGCGCAGATGCTCTGTGGCGAGAACTGTCACAACCGCATGCTCTTCATCAGTTGCTCGGACGACACGTGCTCGGCGCCCGACCCG
AGTCTCTGCAGCAACCGCTCGATCAAGCGGCGCGAAGTCAAGTACGTATACGCGCATTGTGAGTGAGTGTTGCGCTCTTTTTTCTTCTAAACGTATCTAT
TGTGTGAATGGGGTTATAGATCCGTGCGCGTGGAGTACATCCCAGGCCCAGGCTTTGGCCTCATCGCAGCAGAACCGATCAAAGCGGGTGAGTTCGTGAT
TGAGTACGTTGGCGAAGTGATCGACGACGAAGAATGCGAGCGACGCATGATTCAGTACCGAGATCGAGGAGAGGTACGATGGTGGCCGATCGCACCTTAA
TCACTGTATGTGCCGACGTTTCTCACCATGTCTTTGTATTGTGGGTTGTGGGCTGTTAGACGCATTTTTACATGCTGGAGCTCGACAAGGATACACTCAT
CGATGCGCGGTACCGAAGCAACGAATCGCGGTTCATTAACCATAGCTGTGACTCCAACAGCATGACCCAGAAGTGGTACGAACAGTGTCCATGTTGTCCT
GTGTAGATGACCGTGTTTAATGAATGACACGCGTTGTGTGCTGCAGGAATGTGGATGGGATGCTTCGTATTGGCATCTTTGCGCGCCGCAACATCTCGGT
CGGCGAAGAGATCACGATCGACTACAACTTTTCGCACTTTGGCGAGGCCGTGGACTGCAAATGCGGTTCGTCGGCGTGCACGGGCAAGATCGGGCGCAAG
CGCTCTGAGATGGTCAAGTTCGTCAAGGGCGTGCCCGTGAGCACGCTGGCAGCAGCCAGAGCCCATAGCAACAGCAGACAGGGGACACAGGAAGTGCAGG
ACATCGTTCCGGCCGAGATCCAACGACCGATTCAAGTGACGTCACTGGCACTGCTGAAGAGTGCGCAGGTACATACACGTCGTCGGAAAGATCAGCATTT
AGCACGGAGGCTAACACTGCCATGTTTCCCGTTTTGTGCTTAGCTTGATACGGAGTGGCTCAACTTGTATGGCTTTAAGAAGCGCAGACTGTTCTTTAGT
CATGCAAGACAAGCGAAAAAGGCCAAGACTGCTGGCGCTGGTGACGACAACAACAGTAGCAGCACTGATTCGTCTAAGCAGCCATCAGCTTCTTCATCAG
CGACGTCCTCTTCGTCGAGTAGCCCCGTATCCGAATGGTCATCGGCCCCCGAAGACGATGCGGCGGCTTCGACACTGACAGAGTCCTTCGCACGCACGAC
TGCTGCCACCACCAAGAAACTACTCGCGAAGAGCGACTGGTACGAGCGTGTGAAAGAGGGGAAGCACTTGCCTGAGATGCGCGCGCGACCGAGTTACATC
TGTGGCGGCAAATCCGACTGGTCCAAGGATCTCGGTGCACTAAACGCGGCTGCCGTGCAACGAGGCCGAAGCAGCAAGGCACAGATGACGATCGTGACGC
CTACCAATACGAGCGATCCTGTGCCAGTAAAAAAGTTGAACGCCAAACGACTGAGTTTGCTGGAAGCGCGCACGCGGCTCTTTGCAGGTACGAACATGCC
TCATGCGCCTTGTTCAACTGTGGAACAGCGACATGATGCCAACGATTTCACTGTATGTCGCCTGTAGATCTGATCGCGTTTGCGAATGGCACGTCCAAGT
GGAACGCCAAGATCCCATCATCCACATCACTAAACCCCGACCGCATCTTCCGTTTCATCGAACATACAAAGAACGGGAAGCGTGTCCACAACAACGACTT
GGTACTATGTCTTCTGCTTCCTTATTATGGATTGGGCCGATGCGTTGTGATGTTCTAACAATGTGACGTGCGTACGCTTGTGTGCATTTTGACATGCTAT
CTTGCAGAATGACCTGAGCGATGACACCTGCAATCGCTGTGGTGGTGGTGGCGAACTGATTTGCTGCGATGGATGCCCCGCAGCTTTCCACTTATGGTAC
ATGTAGCTTTTGTTAAATCTGCCTTTGGAATGCGTTTTCCTAACCGCAAATGATCGCACCTTTTCGTCAAAACAGTTGTACAAACCTGGTGATGATCCCA
CCGGCAAACGTCGATTGGTTTTGCTCCAACTGCACGAACCCAAAGGCGGCGCACGCCAAGCCGCTGGTTACCGCTGAAGACGGCNNNNNNNNNNGCTGGC
GACGACAGCAACGCGGTACGGCGCCAGTTGCGCACGCACGCGGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAACTCGAAC
TCGCAGCACCTCGTCAAAAAGAAGTACAAGAAGCGCGCCAAGGCCGTCGACCGGTCGTACCGCATGCTCGAGCAGATGCCGCTGCCGGCGATCGCAGACA
GCGACGAGGACGATTAACAACGATCTCCAGACCAGCTGCACATACTGATCAAAAGCTGACACAAACGACAACCTGTCCATAGAGGACCCAGTTGAATACA
CACACAGCACAATACACGCAATGGATGCACGTAAATGCCTTTTTCGATGCGCACACAATCGTCAATGTGCTTCTGGTTTATTGCTCATACAGCTTCGCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCACTTTATCCTTTAAAAACTTTTCGCTATCTTCCTTCGCTCGCTGCGCAACGCACATCAGCATCG
ACACACAGTGGTTAGCGTCACTCATTCACACACTCCATACGCATTCATCAAAGCGAAAAGTCGCTCTTTTTGTTTGTGTCCAATATATGTCCATATTCGT
TCGTACCTTCAATGCCGTGACGAGTGCGGCGTACGGCCCCGAGGACTTGAGCTCGGGCATGGGCACGCCGCCGTCCATCTTGCCCGAGTACGAGTGGTTC
TGGCGCTCGCTGTCGCTGGATGCGACATACTCGTTGGACGCCTCCGCGGCGCTCGGGAAGCTCTCGAACGCGTGCACTTGCTCGCCGTTGAAGCGGTACG
TCGCCTTCATGCCACTCATCCTTGCTGTTTTGTTTCCCGAAGGTGTCGTCGAGTACTTTTTGATTGACTATTGGCAGCCCATGTCCTAATAACACGCGAG
ATCGTGTCCTACTATTAATTCCATTTTTTGGTGAAAGGATGACCTCCGTAGAAAGAAAAAACGCTCGACATGTCCTAAACGAACGTGTCCATTTAGCCGT
GTGCATAACACAGGCGGGTAATCTATCGACTGTGTATTTTATTTTTGCTGATAAATTACGCCTACAACAAGTTTCTCAGTACGATCGCACAGCAGCGAAC
ATGTACGCAATGAGCACTTTGCCGGTGATGACGACGATGGTGGGGCCACCGCCGCCTCCTATGGTCCACCATCCCGTGAAGGAGCTGCGCATGCTCAAGA
TCCTGGACCGGCAGTCGGGCATCTGCCTCTTCACGGAGCAGTGGAAGTGGCACCCACACGCGCACGCAGAGGGCGTCGACGCGCTCGTGCAGTCGTTCAC
GCAGTTTGCGCGTGAGATTGACGGAGGAGGTACCGAATGCGATGTTTCATGCGGCTTTCTACGCATATATGTATACGCGTATATGGAGCTCACTGTTGGC
GCTTGTTGCTTGTGCGCGCTATAGAGGTGATGCAGGTGCATTTCAACCCGACGATGGGCAAGAACGACCCCAAGATTGCGGATGACCGACGGCCGAGCAG
CGGCCCCATGCAGTTCACGGTACTAGCTTATAGACGTTGTCCATTGTAATGCCGCGTATACGTGTGTGCATTTCATGGCTCTTCGCTGACGTGCAAATGC
TCATGATGGTATGTGCAGAATACGACCGGAGCGATCACGATGATCTCGACCCAGACGGCGGTGGTGCAGGCCGTGCTCTTCCACGATCGAACGGCGGCGG
AGCCCGTTGCGGCCGCGTTCAAGGTGTTTCTACAGAAACTGGTGGCGCGCTTTGACCAGGTGTATCGCGACCAACTGGCGAATCTACGGCCCCAATTGGA
GCCTAACGCAACGCTCACGACCGAGCAGGTACACTTTGTTGATTGCAGCACCATGCGCATTAAAGTTGCTGACGTTCTGGATGTTGCTTCCTTTGTTTCG
ATACAAATCAATGGCAGCACACGGCCATTTTGGGCGAATTCGTGGACTTCAAGATCGAATTGGACGCGCAATTGATTCCGGCACTTGAGGGCAGTCTTCC
GAAGCAATGAGAGAGTCTCCATGCTTCACGTTTGTACACTACTGTAGTATCTCTTCTCTGCCACATGATGATGGCAGTTGGCCCGGGAGTGGTGCCGCGA
TCCCTGGAGAAAGGATGCAGTGTGCCTCTTTAAGGTCTTGTCATGCTTCATCGTACGGAATAATCCCTGAAATAGCGGTGCCAAGGTTCACCTGCAGCTC
TACTGTGATGTTGAACCGCTGTACACAAGGTAAAAACAACGGTTAAAAGCAATAATTTCATTTCGCGGTATTGATGTTTTAATGCTGACGACAACACTCG
CTTAGTCCAGTACGCTCTTCTTCCGTGGATCCTTTTGCACAATGGGCTTGTCGCCAGTTGTGAAGCCCCAAACTTCCACGTGGACGCACGAAAACTCCTG
AGCGCTCACCAGAGGGCGAGAACTGAAAGTCTCGCATGCTCCTGTTGTGCCTGACGCCAAGTCGCTGTCCTGTTGATGGAAAGAGAGGGAAAAAAAGCAA
AGTGGTTACTTGTCAAAGGCTCAAAGTGAGTCGAACATAAGCTGCACGAAAGAGATAGTGGCTTACCAGATACAAACCAAAGCTTCCGCCGCCACCCATG
ACGAGCGATTCCTCCGAGCACAACATAAAATAACTGTTTCGGCGACTCCATGGGTACTTGGTGAACCCAGAGTTGCTGCTTCCTTTGTGGTTAGCAAAGG
AGAACAAGAACGTCTCGCCATTTCCATAGTACTGCGTCGCGCGGTGCCATTCGTCTGAGCCAAAGCCACCAAACACGTTGCCCTGGTCGTCTTTGATCAC
AAGCAGCGTCGGACTTTGACCCCTCGTCAGCACCAATAATGTATGCAACGATGAGCCATTGGCTTCAGTGCTGTACAGGAGGCACCACCGGCACAACTGG
CACGTGATCGGCATTGCGTTGTCCAGGTACGCGACTTGATCTAGAGTCAGAATACTGGACGGGTTCATCAATTTGGTCTTGTAGTCCTCGGGCCGGAATG
TGAACGATGGCTTCTTGCTTATCCGAGGAGGCGAGGGTGGCGGCGCAACTAATGGCGACGTTTGCGATGCTTCGTCTTCCGTAGAACCCCCTTCCTCATC
ACCATCCTCACCCAACCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTTCCACAACTCTTCCCATTCGTTTCGAACGTCTTCCACTGAGCTAGG
AGATTTGCCCAGAAGGTCGTTCAACTTGGCTTCAGTATCGCAAAACACTCGCGTGAACGAGGCTTCTTCAGGATCCAACACATCCCACAACTGATCAAAA
ATCCGGAACATCAGGTTGAACAACTTGTAGAAGTATGCCTCCTCGTCAAAAAGCTCCCAAAATGGCTCGGTTGACAGCGCAACAATGTTGATGCTAGGAT
GCTCAGGAGATGGGCTGCAACAAACATAAGCAAAAATGATCAAGTTAAACATCGACCAACCACCATTTCCATGAAAAAATGCAGAAGTAAACACTTACAC
GAGCTTCAAAAGATTGATCAACGACTCACAAATTGCAGACGAGACCAATCCCGCATCATACGTTGGCGCCGCAGAGGGCAGAGCGCGAGTGTACAGAACT
TGGAGTACGTCACTGTCGTTCTTCAACATATATGCGACAGATCGAAGCAGCAGCACACCTCCTTTATCAAAATTACCGAGCAGTGTTGGACGATTAAACC
CATGCTTCTCCCAGATTTCAACGACCGAGCGGTCGAATGCTGCATTCAGGGATCTTGTAAGATCATTCGCTGCACGAAGCTGCATTTGTTGAAACGGGTT
CGAGGTTGTGACAGTCTGTCGACGTGCGCCGACGCTAATGTGGGTATTTGTGCCACTCGATGTTCTGTAATTTGGAACCACATGAGTGCTTGTTCCGCTC
GCCGTTCTCGAGCTTGGAATGTCTAGCTGTCCTTGTGATAATTGACCCGCAGACTCTGCCGATGCTGTGTCAGAACCAAAGATGTGTGGCATTGATACTC
TGTGTCGAAGCGGCGATGTGACTTTTGGCACCGTTGTTGTTGTTGCTTTGTCTGGATTGTTGGGTGATTGAGGTGGTGATATATCTGATCTTGTGTTTTC
CGTGAACGCCTTTGTGATCTCTTCCATGTACTGCTTGTCCGACAAGAAGTTGACCTGGGGCTTCATTTTGAACAGCTGATAAATAGATAGCAAGGCGCTT
TTCTTTGCCTCCAGTCGTGTCAATGCATCAGAGACTTGAACGCGGACATCCTGGAAGATCACATCGTAGTGTTTGATCATGCGCTCCACGACTTGTGCAC
CCACAGCGGCATATCGCACATCCTGGTGCTGCGAATGGGTACTCCGCCGTTGCCCCAAAGGTCCCTTTGATGGTTCTTTCTTGAAGGCAATCACAGGTGC
TAACGTTGTCGATGCTGTCGCAATATCGAGTCCATTATGCTCAGTATGTTCCGGGGATAGCAAAAAGTGCATCAACCCAATGACCTTCTCGAGAACGAAC
TTGCCGCACACAGGCATATCTTGCACTAGGCACGTAATATTGCGAATGCTGGCCTCTTCATCCCGCAGGCGTCCAGATGCAATAAAGGCTTCGTATTTTT
CTGATGTCAGCAAGGGTTCCGGAAGATTCTTGAAAAAATCCATCAATATAGCACCAGCAGCTGGCGCATCCAAGTCGGGAGGCAATGCGCCATCGGTCTC
GACGATCTCACGCAACTGGTTAATGTGTACATTCAGCACCGTTGCGCGGAACAGCCGAGGCGAGTCTGGATTCTCCATGAGAAAGTCGATGCAGTCCTGA
ACAATATTAGGAATCGCGAGCACTGGATCAATGAGCGCGAACCGACTATGGTAGGGATTCTTTGCGAGGTACGAGATGCCCACACCAAACACATACTGCC
ATGGTTTGATGCCTTTGTGTCGGTGTGGGAAGAACATCGACGACACTTCAACAAACTCTTCATCAGCAATGGCGGAATCAACCGCATTGGTCAACTTATC
TGCTGACACCGTCACTTCTTCCGTTAACTCATTTGCTGTGTCTGTATTCGTGGTTGCTGTTGCACTGTCCTCGACTCCATCTGGGGACCCAACAATTGGT
ACAGTGGGCGTTTCCTTTGGCTCTGCGATTTGAAATGGATCGTCGTTGACTCGAATCGCAAAATGGACGTTGCGAATATCCATCACCATCTGTAGAAACA
AACCCATGCCTTCGCAGCATCGCATCAATGCCCACTCTTCGTAGCTGGATCGAATCACTTGGTCGCATTGAACTGAGAAAATAAGCTAGTAGTACAAATA
TCCCATGTGCCTCAGTTAGCTTTTTCCCTATAGCAGACAATAGCAATAGATTGCACAACGCACCAACAGCGTAGACTCTAGCGCGTGCTTGTTCAGTGCA
ATCTTGAGCCAGCAGCGCGCTTTTCCAGCGTCAGTCTAGTGACCACCAGATACAAGAGCCAATGTTAGAATTTATCACACCAGACATTCAAGCACCAGGT
ATGTCAGCAAACATACGTCAGACAATAAAGCTGCTGTCTGGATCGACTGCACCAAATCTGGTTCATCCACAACGAGCGAGCTTGAGTAGAGCACGTTCCA
GAGCGAAATGTCTTGGTTGCTTTGTGGCTTCAGCCCAAGTTTCAAACAGTTTTCCAATGCGGCGCCTAAGAATACAATCTCAATGAGTGACCTACCGGTC
GCACAATTGCTCAGATGTGATGCAAGGAGAAAGAAGAAATACGTACAGTATTCGTGGACGCACGGATCATCCTGCGTCAAGACGACCACTGTCTTTGCGT
CATTGCCTCCTGCCGTCGTACTCGCATCGGTATCTGCACTTGTGGTGTCTCCCTCTGCTGCCTCGCTGTTCTCGTCGAGCACCGTGTCATCCGTCAAAAG
ACGCTCGTTCGCTGTCTGCACCACATCTAGCGTCGTCTTCTTCATACGCGTCTATAATAAACACGCATGGAAAAAAGTTAGCATTTTCGCCATCGAACAC
TGTCGCTGACGTTGATTAAATGACAATAGGGTACGCACCAGTGCATCAAACCGCAGCCGCACCGAGTCATCTTCCTTGTCTTCGAGCTCCAACTTTGCCG
ACAGCCAGTGGCTGAGCTTGCCCAGCATC