Description :
From Genome Similarity Track
Location :
Scaffold_1109:831- 6335
Sequence
5504 bases(100 bases per row)
CTCAAGATCCCGCCACAGGAGGCAGCAAGTACGACGCAAAGGAAAACAAAGGCAAGGGGACACACCCGCAAGGCAACCCTACGGCCAGATCCCAGATCTA
GGCCCTGTATCCACCAAGTTCGAATATTCGCTTGGGATCCAGAAACAACTACGGACGCAGAGTGAAGATCTTACCAATACCGCTCGACCCCATCCCCACG
TCTCGCCAAGACCTCAAGCTCAAGCTTTACCACATGAACGCTTCCGAAGTTACCGAGAGAGCAAGTTCCCACCCTACCGACAGGTACACAAGGTGAGGAA
AGTTCAGCAGATCATGGATCATCGGGGGACCCCTTTGTTAGTCGGTGTCTGGGTGCAGCAATCTTGCCGATTTTGCTAATCATACTACACCACAATGGTG
CGCGTGCCCGGAACGTTTGGTGACTCGGGATTCCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGACCCGAGGGAAGAGGCATCATCGGAGGTCG
GATGGACGAAGACGCTGCTGAATGAAGCAAGATCTGCGGATCGATGGAGTGCTGGGAGGAATTCTGTCGACGGAAGAGAGGAGGATCCGGATCCGGATCT
AGAAGAGAAACCTCTCTATCCTCCCCAGGTACCCCTGCGGATCTTGACTTGCGTCAAGATCCGCTAACTAAACAAGGAAAAGTGAAGGCAAAACAGTATG
CATTTGCAGATTCATCGGTCGAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAAAGACGAGAAAGAAGACCGATGCGAGTAAGTCTACGCGGAA
GCAAATGCAAGCTCCTGAGTCGGAAGAAGACCAAGCTGGCCCCAGGTCAAGCTGGTCCGACAATGATCTCGAGTAGTGTGAAGACTCGGAATCCAGGTCG
TCATACCCGCGGTCTGATACCATCCAACCAGGTTCGAGCCAGAACCAGCAAGAAGCCAGTCGGATTATTGTCGGACCGGGTTCAAGCTAATTGCCTCACG
GATCCCGCCTCGCCAGTAGACCAGACGGCTAAAGGGTCTTCCGACACCTCATCGGGCACCCTACAACGGCACTTCGAAGCTGCGATGAGCCGTTTCCTGG
TCGAACAAGGCATGAGGGCACCCAAGCCGCAAACGCAAGTGTTCCATGACCATGGAGCACGAGACATGGAAATGGAGTCAGTGGAGGGAGACAACTCCCA
TGATGAGTTCGAGCCAGATGATCTGGATGGCCCATCCCCTTCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGG
GTACGGATCTCAGCCATATCGGATCTGAAGGAGCTCACGGGCAAGGATCAAGACGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCA
TGAGAGATCAAGCGTCAGATGCCGAGAAGTGTCTGACTTTTGCAGATCTGCTAGCGGGGCCAGCCCGAAATTGGTATCGGCAGCTGGGCAGATGCACCAG
GAACAAGTGGCCGGATTTGCTGCGCAGTTTCCAAACCCAGTACTGTGGATTGGGGGTGTCAGTGGCACGACAATACTACCACGCTCGCCGCCGAGCGGAC
GAATCCCCGCTGGAGTATATTCATCGGCTAAATGTGGCCGGGCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCAANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCCACCAAGTCATGGCGCCCGACTCAGGAACTGAATCGGGATCCGATGGCTCG
GACTCCGATCCAGAGGATTACCGCAGAGTCTGTCTCACCGCCCCCAACGATCGTACGGCGAAGACTGGAGACAACTCCCGCACTGGTGATGCCTTACCCG
GAGACCGTGGGATGTACAGATTCCGAGATGTCATGGACGGCACAGGACAAATCAGGTGCTTGCAGTGTGGATCCCGAAAGCACACAGAAGCTGGATGTTG
GAAACATCTGGTTTGTGAGAAGTGTGGCAAGAAGGGTCATCCCGGGGATCATTGTTTCTACGTGTGTCGCGGTTGTGGCGAGATCCACGACGCCGGCAAG
TGCCCGATGGAAGCGTTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAACACAGAGGGATGTTGCCAGAAGTGGCAGAGAAGGTGTTAAACTAGG
ACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGATATTGCATTATGCATTTGTGAACAAGACGTCGCTAGATCCAGGTAGCAAGCTCCTAG
ATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTTTCTAGTTTGCGCCAAGTGGATGAGTTTTATAGATCCGAAGTCTCTTCAAC
CCTGGATCTACAAATGGGAGAAGCGCGCGGTTATTGGGAGAAACGACAGCATGGCCAATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCC
AAGGTTTGTCAAGGCACTGGATCCCGTAGATCTGAAGATGTTGGATCTATGGATCTGCTGACAGGGGAATCCCGTGGATATTGGAAATACCATGCCCCAG
GAAAATGATTTCGACAAGCCAAGGTAGGAGGCAAGATCAACAATGAAAAAGCGATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGC
CTTTGCTCGTAAGGCTGGGTGCCAAGTGGATGGGAGTCGGATCCATGATTATGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATC
CAGATCACGTTGGCAGTTTGTTTGGTGTATTGGTTCGATATTTGGGTCGGAGACCTCGCTGGTCAAGATGCCATCCTTGGGATGGATTTCATGGTACCAG
CCGGGGTAAGGTTAGATCTGGCAGATGGGACACTATGCTTCCCAGATGAGATGCGGATCCAGCTCAGTGGACGACGACCGTTGTTCAGGGCGAAGATGAG
GACCATAAGGGCAGATAAAACGACCTGGATCGAGCCCGGAGAAATATGGGAACTGCCAAATCGGTTGAAATGGGTGGAACATGATAAACCGTGGGTCACT
CGGGGTGAAAAGATGGTACCTACAGTAATCGAAGGGCCAGGTCGATCATAGTATCTTCAAGTTACGAATGTCAGCGACAAGAGGCTATTAGTAGACCACT
ATGAAGAAATTTGGCGATGGCTGGCGAAAGATAGTATCCCTAGGCGGCCTGGAATTGTATCCGTTGGCTATAGAGAATGGCAGAATCTAGCGTACGAAGC
AACTTCCGAGATTGGACCTCTCGGGGAGGTGGAACCCCCGGCGGAGCCGATTGGCCCCTTGGTGGATCGACCTTCATATCCAACTCCGCAGAAGATCCTA
CAGAGGGATCGTCGGATTGGGATCCAAGTGGTAGAGGCTGGATCCAAGGCAGCTGGAGATCCCCAGAACCGGTCCCTCGATATCCAAGGGTCGATGGATG
GGGGGTTGCAGGGAATTGAAGTCGGCTCGCTGGGTCCTGCTGACCCACAGTTGGATCCGAACTTTCCATCGGACAAAGTGCCTGGATCCTTATCGAGAGT
GGCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCGTTAGAGGATCAACTCGATCCAACTGGTGGCTTCCCCGATACCAGGGTACCTGATCCCACG
AAGACAGATGGACTGACAGGATGAAAGAGGGTCGCGGTGCTTGGATCCAATGGTGGACCTGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGC
GGGGATCTACACGCCAAGGATCTCGGAGAAGGCCTGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATC
CAGAGGCGAACGAACCCGCGGAAGTGGATCGGTTACGCCAGAAGATCTGGGAATAACGACATCTGCTGATTGGTAAAGATAATGCATTACCGCCCGCTGC
CCGCGGAGTCAAATGTGACATCGATGTCGGCAACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTCTCGGATCTG
ATCAAAGGTCTGCTGCCAGCCAAAATCATCATTTTCTCAACCTCCCCGTGGGCGTCACCTGTGGTGATCATCATTAAGAAGAACGGAGTGGATATACGCC
TGTGTATTGATTACCGGATGGTCAACGGTCTGACCAGACTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGACTTGGATAAAGTGCTCTG
GTACTCTTCCCTAGATATGGCAAGTGGGTTTTGAATGGTGACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTCGGACTGTTCGAA
TGGAACCAAATGCCGTTTGGATTGAAGAACGCGCCCCAGATTTATCAACGCCTGGTTGATAATGCCCTCTATGGATCTACCCGAGAACCGAAACCCGTAG
GGGATGGATCCGGCGAAGGTGATGCGGCCAAGTGGATCCATTCGAAGCAGGAGAGCCAGGAGATCTGGGAACACTATCCGTGTTAGGGCGCAGGTGCTAT
ATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGCTGTGCGAGAGAGAGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCG
TGGTGAAGAGTTATTGGGGAATGCGCAAGGTGGATTATTTAGGTCATCGAGTCTCCAAGAAGGGATTGGAGGCGAACCCTAAAGATCTGTCTTCGTTGGC
AGACTGGTCCTTCCCACAGTCGTTACGGACGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCTGAA
GTACTCTATGAATTGAGGGAGGTGGATTTTGCTGCGATGGCCACTTCGGCTATCCGGATCAAAATCCAGCAAGCTGTGGCCCTAGAGATCCCGGATATAC
GAGGGGATCCAAGTAGTGCGACGCCGAAAGACGCCCTAAAACAGGAACTGGATCCACCCCGGGACCAGCGGGGAGAGGATCCAATTTGGACAGAGACGAC
GGAGGAGAGCTCGGAAAAGGTGGAACCTCGGTGAATCCGAGCTTAGCATGCGTTCGTGGAGCTAAGGAACAGGATCGTGACGACGCCCATCCTCCGCCAT
TTCGATCCGGAACGTCAACCTACGGTGATAGTCTATGCTAGTGACTGGGCAGTCTTAGCGGCTTTCGTACAAGAATATGAGGGGATCTGTCATCCGGTCA
CCTTCGTCAGCCGAACGCTAAAGCAGAATGAACTGAATTACGGAGCGGTAGAGAAGGAGATACTCGCGCTCCTGCGCGTGTTAGATCTCAATTACAACCT
GCTG