Description :
From Genome Similarity Track
Location :
scaffold_335:831- 3142
Transcript NameFunction/comments
g7390.t1 hypothetical protein PHYSODRAFT_328314
g7391.t1 hypothetical protein PHYSODRAFT_558658

Sequence
2311 bases(100 bases per row)
TCTTGGTGATCGTAGCCATCGTCTTCAAGGACCATTTCTCCGAGTTCTCGGACTTCATCGGCGCCTCGTGTATCACCACCAACTGCATCCTCCTACCGAT
TGTTTTCTACTTCATGAAGGCGTGGGCACGCGTACCGCTGTACGAAAAGGCTGCTGGTAGCGCTGTGCTCTTTGTGTGCTTTGTTCTCGGGTGCTACGTC
ACGTACACGACTGGAAAGGAGCTCTTCTTCCCCACGGACAACGACGCGGAGTTCCCGTTCTGCGACTCCGAGTACGAGAACAAGGTCTACTACAACTACA
CAGCCGCACACGAGAACTAAACAACCAGTCGGTGGCTCGGGTGAAGGAGGGCGCCAATCACTGAGATTAATTGTCGAACCTATGCGTGCAGGAACATGAA
AAATATAAAAAAATATTGTTGATTCTCTTGAATAAAATAATCTTCTTCTTCCATTTCTTCTCTTCGTAATCAATTTTAAGAATGTACTTCAAGCAAAAGA
AAAGGAGCCTATTATTAGAACGGCTTTTCTTTCTTTATAAAAATACTAAAACTGAAGAATGTTTATTTCTTCTTTTCGTTTATTTCTTCTTTTCGTTTCG
CAAAATCGTTTAATCGTAAACCTTATAAAATTTAAAAATTCCAAGGCTAAAAACCAAAACAAAGCAAGAAAACATACAACGATCTTTCATTCATGACAGC
AAGTCTGCCAACAATTCTAACTGTAAAAGGCTTACTCGTGGGCGGCCGTGTAGTTGTAGTAGATGGTGTTCTCGAACTCCGAGTCGCAGAACGGGAACTC
CGCGTCGTTGTCCGTGGGGAAGAAGAGCTGCTTGCCCGTAGTGTACGTGACGTAGCATCCGAGGATGAAGCACACGATGACCACGACAATAGCCGCCGTC
TTCTCGTAGATGGCAACACGCTCCCACGCCTTGATGAGGTAGAAGACGATCGGCAACAGGATGCAGTTCGTGGTAATGCACGAAGCTCCAACGAAGTCGG
CGAACTCTGAGAAGTGGTCCTTGAACACGATAGCGAGAACCACAAGGATCGTCACAATGGTGACACGCAGCGCGACGTACTTGATAGCGTTAGCTCCAGT
GTACTCTGCTGCCTCCTCCTCCTCGTTGTCCTTGTGCACACGCTCTGAGTCGGCTACAGACACGTACGACATCTTGGAGCGGCGGTTGGACTGCGAGAAG
CCAGCGTCCGACTCCTTGTTGACGACCTCAGCCGGAGTCGAGTTCTCCTCGAAGCCGAAGCCGTTCTCAATGTCAGCAGAGGCCCTCTTGTGCATGCCCA
GAAGGATGCGCTCGGCCAGATAAAAGGCCGGGTTCGCGATGACCGAGAAGGCGATAGTAATGTGCAGCTGCATGAACAGGTAGGCCAGCACAATGACACC
CCAGTCAGGAGCGAAACCAAGCGACGTCATGCCCGTCTCCTGGTCCGGGTAGATCGTGAATAGCAAGTTGCCCGAGATCTGGCAGCCCACGGCCGAGTAC
GACGTACTAGCGAGTACCAAGAAGAGAACCGACACGAAAGCGACGGTAATACCGACGACACGGGGCATGCGCGTGGGGTCGCTGTGCTGACGCTGCAGGT
CCGGGATGACGATACCGGCGCCGTAGGCGAGCGACAGGTTACCGAACACACCGGCCACCTGCTGGAACTTGAGGTCCGGGAACGGCACGCTGGGGTGGCC
GCGCATGCCATGGATCACTACTGCGACGCCGATGACGTCGGCGATGATCGTGCCCATGCAACCGGCGAAAGCGGCGCCCGAGCCTTCCTTAAGCGTCGGC
ACTAGGCAAACCGGCAACACCATGAGAGCCATGAGAATGGTCCACGTCGTTTGGCTGAAAGCGCCGGGGAACAGACCGTCGAGTAGTTGACCGCCGAGCA
CGAGGAAGACGCACGGAATCAACAGACACGAGCCCATCTGCGAGATGATGCACAACCAGCGGCCGGTTGCGCCCATGCTCCATTCACCGAGGTCACCGAA
CGTCTTGACCGACCGGGGGGCCAGCAGCATCACCTTGGACATGGTGATCGAAGAGTAGATGTTGGCGAACGCCATGAAGGCCATAGCGATCACGGCGATC
GTCGGACCTGCCCGGGCGAAATTACCGGGCATACCAAGCGTTCCAATGCCGTAGATGCAGCAGAAGAGGTTGAAGCACGACTTGAGGTCCTCACCGGTGA
GGAACGGACCTTTAGCCATGGTGAAGAAGTCCGGATCCGAAGCAGGTAGGTCGAGTGTAGGTTGGAGGGGAAGGACCTGCGGCGGAGGCGGCAGAATGGA
GAATGAGCTCC