Description :
From Genome Similarity Track
Location :
Scaffold_155:831- 2388
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.22Myb-like DNA-binding protein

Sequence
1557 bases(100 bases per row)
ATCACGATCACGACCAGTGCCACCCGGGTGATCCGATGGCGACTTTCTTAAATACTTGCGGGCACGCCACACGCGGCAGTGCGACTTCCAGCGGATCTTG
ACGGCATCTTCCGTTCGTCCAGGGAGCATCGCAGCAATCACAGACCATCGGTTGCCTAGTCTCGCCTGGGCTTCCAGAATGATGCGATCTTCCTCGGGGG
TGTACGCTCCGCGCACGATGCTCGGGTCAAGATGGTTGTGCCATCGTTCACGGCATTGCTTGGAAGTTCGGCCAGGAATCTTGGCAGCGACTTCGCCCCA
GTTCTTTTGCTCACTCGCAACGAGTCGACGCAACAAATCGTCCTCTTGAGGCGACCAGTGGCCCTTGACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTTGCAAGCACTGAGTATGATTTCGCCCCGGGACTTCGGCAGCGATGGCTTTCCAGTTTTTCTCGCGGTGACTTTCCACGGCATGACGCAGCG
CCTCATCTTCTTCTTTCGTCCATCGNNNNNNNNNNNNNNNNNTCCGCACCGGGTGGTTGTTACGCTCAATGATTGCGTACGCCGTCGATGGCGGCAAGCC
CAGCGGACCCGTGTGCGGTGTCGCCATGAGCTGCTTGGACGTAATACTCTTTCGCTTCACGGGTGACGTGTGGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGCGCCCCATTAACACTGTTGTTCATCGACGAG
TGCGGAGGCTGAGACTCACTCGTTGCGACGCTCTTCCAGTCCACGACCGGTGGTGCGAGCTGCTTGGCTCCATTANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
CTGGCAGCGATGATTGAGGTGGTGGTGCCGTGATCGACAGCGGCGAGCGCGCATTGCCACCAAACGAAGCGTGCATCGGCTGCGGTTGCTGCTGGNNNNN
NNNNNCCGTTGGCGTTGGTAGCATTTGGTGCTGACCGTATAAACCATTTTCAGCGTGGTGGAGGCTGTGAGGGTGGTGATGATGTTGTGGTACAGGCGAA
CTCAGGGGAGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN