Description :
From Genome Similarity Track
Location :
Scaffold_2679:831- 2325
Transcript NameFunction/comments
Phyta_totarag14731hypothetical protein

Sequence
1494 bases(100 bases per row)
CGCAGTGAAAAGTCGGCGTGGAGAGCGTAGGAACCTTGCTGATCCACCCTCTTGCCCgatcttcaacttgatctTTCCCAGTGAACTCCTTCAGATCCGA
GATGGCTGATATCTGCACGCGTTGGATAAGCGCGGATCCAGCTGATCCAGGCATCGTTGTGACCACTGCAGCACGAGTGGGTGGAGCATCCAGATCGTCG
GGGTCGTATTCTTAGAGAGCGGGGTGGTGATCGGGCGATCCGACCGACTCCGTGTCCACATCTTGCGCGCCAACGTTCCTTGTCGTGGCTGCGACCGGGG
TCGGTGCCGTGATCTGCTGTTCTTTGAGGAATCGGCTCATAGCAGCTTGGAAGTACGATTCCAGTCTGCCTGTTGATCCGTCCGGCGAAGTTACGTTCGT
GATCTGACTTAGCTGTCGCGGTTGCATCCGATCCGGGGACTTCCAGCGAGATTGAGATCTCAATAATGCTTCTCCGGAAGGTCCGAGAGGCATACGTTGC
GGCCCTATAGTTCCATCTGAATCAAGTTCTGATGTGACCGATGCGTAATGTGAAGAGCTAGTCTGGTACTCCGTCGTGCTGATCCGGGGCGAGATCTCTG
GATCTTCGATCCGTCCATTTCCACCTACCAAGATCACCAGTCTAGCGAAATGCTCTTGGGAAGTAGATTTGACGGTATATAGATCCAGATCGAACAGTCC
GTCAGCGTCGAAAGCACCGGCGACTAGACCTGCCTCTTTCAGTATCTGAAGTAGGTACTTCACCGCAGTCAGCTTGTTGGACGTCTCCGGCGGAGCTGAC
ACTGGTCCCTTCAGATCTCCGATCTGCTCTACCTTCATGATCTTCATTGTTGGACCTTGGAGTAAGAACTTGCGTAGCGCCTTGTGATGAAACGCAAACT
CTAGATCCTGATCGGTCCAAGTCGATGGCGATTCCTTCTGATCTTCGCCTTCCGACTGAGggccttcattttcttccaCGTAGTCTTCactttctccttc
tttgTATTGGATCTTAAGActagcgggcttagggtcGCTTTTTTTCGTCGCGAACACACACTGTTCGAGTTTTCCCTTACCGATTTTTCGTTGCGGCGCT
CGATACGCATCGAGAACCGCAGGGGTCCCCGAAGGGACCTGGGGAAGAGGTTGAGGTTTCTCTTCTCGATCTGGTTCCAGATCTCCCTAATTTCCGTCGA
CAGAGTTCCTCCCAGCACTCTGTCGATCCGCGGATCTTGTTTCATTCAgcggcgtcatcgtcgatCCGACGTCCGACGACGCTTGGTCCCCTTGTTCAGT
CTTcacttgaacttcttcttgggatTTACGGAGAAATCCCGAGTCCCCAAAAGTTCCGGGTATGCGCACTattgtggtgtagcgggatccgTCAAATTCT
CACTGGGACTAGATCCGGCTTGCCAACAgtgcccagacaccgactaatGGAGGGGTCCTCCGATGAcccgtgatctgctgaactggtcaccttg