Description :
From Genome Similarity Track
Location :
Scaffold_10:83096- 86891
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_10-abinit-gene-0.126Glutamate synthase
Pytve_DAOMBR484maker-pve_contig_10-fgenesh-gene-0.19Expression site-associated gene 8 (ESAG8) protein

Sequence
3795 bases(100 bases per row)
ATGCAGCCTGCTCTGCGTTCACGTGGCCCGGCGCTCAAGCGCGCGACGGCGCTGACCCAGCGCGCGTTCGCGTCGGCGGCGGCCCCGCGAGTCGAGGACG
CGGCGTTCGAGCGGCGCGACGGGTCCAAGGGCAAGATCGTGAGCGAGCGCGCCTTTATCGACTTCAAGCGCCAGCCCGACCCGTACCGCGACGTGATGGA
GCGCGTGCACGATTGGAACGAGATCAACACGGAGCGGCGCGACCCGATGGAGCGCAAGGTGCAGGCGGCGCGCTGCATGGACTGCGGCACGCCCTTCTGC
CAGACCAACACGGGCTGTCCCGTGAACAACCTGATCCCGGAGTGGAACGAGCTCGTGTTCCGCGACGAGTGGAAGGAGGCCATCGACCGTCTGCATAAGA
CCAACAACTTTCCGGAGTTCACTGGCCGCGTGTGTCCCGCGCCGTGCGAGGCGGCGTGCGTCGCCGGGCTCATCGACGACCCGGTGACGATCAAGAACAC
CGAATACGCCATCGTGGACCGCGCGTTCGAGGAGGGCTGGATCGTGCCTCGCATCCCGCACCGGAACGGCTTGCGTGTCGCTGTCGTGGGCTCTGGTCCT
GCGGGTCTCGCGGCTGCCGACCAACTCAACCAGAAGGGCTACCACGTGACGGTGTACGAGCGCGAGGATCAGGTTGGCGGGCTGCTCATGTACGGCATCC
CCAACATGAAGCTGGACAAGAAGAAGGTGACGCGCCGCGTGGACCTGCTCAAGGAGGAGGGCATCGAGTTCGTGACCAATGCCGAGGTCGGCGTCAACGT
TTCTGTGGAGCAGCTCAAGTCGGACAATGATGCGCTCGTGCTGTGTCTCGGCTCGACCACGCCGCGCGACATTGATGTTCCAGGCCGCGACCTGAAGGGC
ATCCACTTTGCCATGGAGTTTCTCACGAAGAACCAAAAGCGGCTAATGCTGACGGTCGACGGCAAGCTGCAGAGCGGCTGGGACCGCGACTTCGTCACGG
CTGAAGGCAAGGACGTGATCGTGATTGGCGGCGGTGACACCGGCACGGACTGCAGTACGTTGTTGCTCGTGTTTGTCATTTTTCTGTGATGTATCTCTGG
TTCTGACAGTCGTGTGATATTCAGTTGCGACTTCGATGCGTCACCGCTGCAAGTCGGTCACCAACCTGGAACACAATCCGCAGCCGCCACCATCGCGCTC
GTCGGAGAACCCGTGGCCTGAGTACCCTCGCATTTACGGCGTTGACTACGGCCACGCCGAGGTGCGTGCGGTGTTTGGCGACGATCCTCGCAAGTACAGC
CGCATCACCAAGGAGTTCAAGGGAAACGCCGAGGGCGAGTTGACCCACGTGATCACGGTCCTGTCGGAGAAGAAGGACGGCATGTTCGTCCCGATCGAAG
GAACGGAGGAGGAGATCCCAGCCGATCTGGTATTGTTCGCCATGGGTTTCTCGAACCCGGAGCAGCAGATCATGGAGAAGCTCGGACTCGAGATTGACCA
GCGCAAGAACGTCCGCGCGGCGTACGGCGACTACCAGACGTCGGCGGAGGGCGTGTTCGCTGCTGGCGACTGCCGCCGCGGCCAGTCACTAGTGGTGTGG
GCCATCAACGAGGGTCGTGGCGTGGCCGACGCCGTGGAGAAGTACTTTTTGCACGAGGGGTTCCAGCCGGAGGTCTCGCAGAACCAGCGCTACGGCTGAG
TGTAGGTGTCCCCCTCCGTTCTAGATGAGTCTAATTGTACTGGTATTCAAATTTAAGGACAGCCCGAGTGCTCGCACCAACCGTGTGTCGTAGTCGTTCT
GTATGCCTGACTGATGAAGTCGCACACGAATGACTGCTTCTCGCATTCCTAGTCTTCTCCGCTCAGACGCGAATGATCGGGACGACGCCTCGCAGGCTGG
CAATGCTCTTCTGGAGCTCGCCGGCGTGCTCCTGACGGTCGTTGTATTGGAGGTCGAGGATGCGCACTCCACGCAGCATCGAGACATCTCGCAGCGATTT
GCAGTCGCTCAGGGTCAGCACGTGCACATTGGCAAGTGCCGCGACATCTTGGACACGGTCGCAGCCCGACAAGTTGAGCGAATGACAACGGCCGAGCGCC
GAAACGTCGCGTACCTGGCGGCAGTGCTTGAGCGAGAGCGTGTGCACGCCAGCGAGTCCCGAAACGTCCGCCACTTGCTGGCAGTAGCTCAAGTCGAGCG
TGTGCACGTTCGTGAGCGGAGTCACATCGCGAAGTCGCGGGCATCCTGCGAGTTTGAGCATCCGGACGTTCTCGAGCGGACTGACATCGTCGAGCGCGTC
GCAGAAGCGCATGTCCACTTCGCTTGCCGTGGCGATGGCGGACACGTCCGTGATGAGCTGACAGCCTGACAAGTTGACCTTGGTCACGTTCTGCAGTGCT
GAGGGACTCAGCTCACGAAGCTCGGTGCAGCGGTAAGCGTTGAGAACGCGAACATCCGACAGCGTCGAGCCGAGGTCGCGCAGATTCTTGCAGAAGCTCA
CGTCGAGTTCATCGATGTCTCCAAGGCCGTCAAGCGTCGAGAACTGTTCGCACCGACTGAGCACAAGCTTGCGAAGTCCAGTCAAGTGCGAGATATTTGA
TATGCTTGTGCAACTGGAAATGTCGAGTTCCTGGAGCGGTCCAGGCTCGCCGCTGTTGTTGGCGCGTCCGAGCATTGAGATGTCGCGGATGAGTTCGCAG
TGACGCATGGAGAGCACGACGACGCCCTCGGCCAGGGCCGAGACATTTGTCACGAACTTGCAGCGCGATATGTCGAGCGTGTGGACGCGGCCGAGCGCCG
AGATGTCGGTCACGTTACTGCATCCTGTGAGATCGAGGTCATGGACGGTGCCGAGAGCCGAGACGTCAACAACTCCGGTGCAGTTGCGCAACGAGAGCGA
GTGGATCGACCCGAGCGCCGATACGTCCGCGATGTTGACGCAGCTTGACAGGCACAGCGTGTGCACCGAGCCTGACCCAAGCGCGCTGACATCGCGGATC
TCGGTGCAGGCGGCGAGGTTGAGATCTCGCACGTCTCGAAGCGCCGAGACATCGCGGACGTGAGGGCAGTTGCGCAGACTCACGCGTTGCACGTTGGCGA
GCGGACTCACATCGACGACTCCACGGCAGACATTGAGTGCAACTGTGGTGCAGTTGCGGAGCGGCTCGAGCTCGGTCACGCCGTGACAGTACGACAAGTC
GACATGCCGAGACTTGGAGAGGAAACTGACGTCTCGGAGCGAGCTGCAGTAGCTCAGGTCGACCTCGCGCACGCCTTGCAGCCAGTGGAGCCCGTCGATG
CGGCTACAGCCGCTCAGTCCGAGTTCATCGAGATTGTTGATGCCGTCGAAGAGCTGCACGCGATAGATGCCCGACAGGTTGAGTCGGCGCACCGGTCCGT
CGTGGACGAACTGCTGGAGAGCGTCAGGACATTTGTATGCGAGTCGGTCGAGCGATCCTTCAGGCTCCGGCTCGCCTTCTGGTTCAGCATCGTTGACAAT
GAGACCGCCAGCCGCATTGACGTTGTAGTGGATGCGTTCGCCGGTCGGGGTCGTGTCGTCGCGCTCGATAGGCTGGAAGGTCACATTCGTCAGGTTGGGC
CACACGTGGAGCAATGTCCGGAGCTGCTTGACACTACTGGCGATGGTAGCCGGCGCGCGAAGCTGTACGTGTTCGTGCAGGACGCGGTAGAAGAAGCTGC
TCAGCTCGGCGAGCGCCACGGCATCGCGCAGCGACAAGAACTCGAGCACGTGAGAGTCCCAGAGCTCGAGCGGGAGCGTGAGCTCGAGGTGGTTG