Description :
From Genome Similarity Track
Location :
Scaffold_61:83083- 85556
Sequence
2473 bases(100 bases per row)
TTGTCTCGCTCCCAAGGGTTGCGAGACTTTGCACCCAGTATTCGTCCATAGCCGGGATATGGGCGGAAAGACGGACGTTGAGGTTCATGTAACTCACGTC
CGTAAGATTCTTACACTTATGCGCGAGCATAAGTTGCGCCAACCTCAAGAAGTGTATATTCGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGT
AAACACGGCGTATTCCCTAAACCTAAAAAGATTAAGGCAATTGCCAACTGGCCTGTGCCAGTCGACGTTAAATGATTAGGAAGTTTCCTTGGTCTAGCGG
AGTACTTACACAAGTACTCGCGCAATTACGCCTAGATGACCGTTCATCTCTCTCGTCTCTTGAAAGAGAACGAGAAATGTCATGGAACGCTGATTGTCAG
CGTTCCTTGAAGGTATCAAGCAGAGCTTGATACAATCGCCCATCTTGGCGATTGTAGACCAAGACAGACCATTCCATGTGGTCTGTGGCGCCAACGATTT
CGCAATCGGCTGCGCGTTAATGCAGTACGATGCAGACTGCTCAGAGCGCGTCGTCTGATATAAATCGCGGTAGCTGCAAGCAGCTGAGAGTAATTATCCA
GTGAATGACAAGGAACTCCTTGCCATGAAATACGCACAGGCTAAGTTTCGTGTATATCTCTTTGGAGATAAACCGTTTTTATTCTATACGGACCATCCGT
CATTACGCACGGCGGTAGATAGCCCACACCTCTCGCAATGGATGGCGAGGTGTCTGTCCTCCTTTGCGGAATAAAACTTCTCGTGGAGTACAAACCCGGA
AGACTTAATGTCGTCGCGAACGCGTTGTCGCGCCGACCCGATTTCGAGTCGGCTGCGCATTCCAACAGTGAGGTTGATACCACTGTTGCAACACTAGTCA
CTAGTGTCCCGTCGTCAACATTTCTTGACGACATAAAAAGGCCTACTCAAAAGATAAGGCTCTTCTGCGACTAATGGATCATCTGGTGACTTCATCTTTT
AAATCTCTCAGAGATTTACCGGCTTTGTATCGACCTTCCGCGGATCGATACACAATACACAACGGGTTGCTGTATTATACAGCCGTTGCCGGCGAAACAC
CTCGTGTAGTCATCCCAATCATAATGATTTGCGCTTGCGCATCTTGTATGAGTGCCATGCTGCACCACCTAGTGGACATCGTGGGCATGAGAGGACTTAT
CTCACGGTAAGTCGCGACTTTTAATGGCCCCGCCAGTATCAGTTTGTGCGCAGGTACATTCGTGCTTGTGAAGTGTGTCAATAAGTAAAGCCCAGTCCTT
CATCCTGTGCGCCACTACAGCCTCTACCAATCCCGGTAGAGTGCTGGCAGTCAGTTCCAATGGACTTCGTCTTTGGTTTCCCCGAAGACGCTCGCAAGAA
TAATGGTATTATTGTGTTCGTAGACCGTTTCAGAAAGATGGTACTCTTGCTGCAGTTAATGAGTCAATCTCAGCACATGGTTGTGCCCGTGTCTTCAGTG
ACACGGTATTCCGACACCACGGTCTACTCCGTGAACTAGTCTCTGATAGAGATCCTCGATTCACGGCAAAGTTCTTGCAATCCATGTTCCGATCCCTCGG
AACACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTGATGGTCAGACCGAACGAGTCAACCGCGTCCTCGAAGAGATACTTCGAGGATACGTCCAA
TCTTTCACAGATTGGAGCGAATTTTTGCCGATAGTGGAGTTTTCAATCAACAACTCCGTGCATGCATCGACAACGCATACACCATTATTCGTGAATGGCT
TACGCCTACCCACCCATTCAGAGTGTGACACTAATTCAAGGGGGGGGAAGATTTTCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATCACGTGTAGAGGT
ACTCGACGACGCGAACGTTGCCGATGTCGATCAAGTCGACATCGAAGAAGATAAACTTATTATTAGTGATGACACTATTGCTGACCCAGATGAGGATGAC
GATGCTGGTATATTCAGCATCGCCAATGAATACATCAGCGAGAATGAGAACACCCTCGCTGAAGAAGAGGATGACCTCCTAGCGGTGCGCACAAGGCGCA
CTGCAACAAACCAAAGTGATGCAGCAGAAGATTTCCTGCTGGCACAAGAAGCAGTGTTCCGCTTCGTGCAAGACTTTATGACTAACGCGGTGGACCGGCA
GAAACGGAACGCTGACAAACATGAAAGAGAAAACGTTCTGCTATTTAATGTAGGATACTTTGTTCTACTGTCTACGGTAAATCTATATAAGCACGTAGTA
ACTAATGTGGGTAGTAGTAAGCTACTTCCCAAGTACGTCGGCCCGTTCCGTGTACTACGTCGCAAAGGCAATGTATACACAATCGAGTTGCCTCGTAGGA
TGCGTACGCATCCTACGTTTTATGTCGGTCGCCTCTTCCCGTACCATCACCACGAGTTCTCTTCCTCGGGCGA