Description :
From Genome Similarity Track
Location :
Scaffold_22:83078- 84281
Sequence
1203 bases(100 bases per row)
TCCTGCATTGCAATAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGA
CGACCTTGGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAG
GTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGTGGCTCAAACGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGA
TCCGAGAGTCGGCGTCCATACACCCAACTTCTTGCACGTCCGCCAATACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCG
CAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGTTCACCCTCTCTTCCGACATAGTTGCTACATTGAGCTTCAGCGATTGCGCGCGTGGTGTC
GTCCCGGACGACACCGCGGTAGTAGCAGCGACATCGCGTTGCTCCTTCAGAATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGCGTACGCA
GCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTG
AGTTGCAGGCGTAGTGGAGCTTTCCATGGGCACCTCTGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGT
CGTTGGACGGACTACGAAGTGCTACCAGGTGTAATGGGCCTACTTTGGCCCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTA
GTTTAACTTAGAGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTT
TGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATACTATGCATGTCGCTCATTGG
CTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTTTACACCAA
GGT