Description :
From Genome Similarity Track
Location :
Scaffold_9:830702- 831926
Sequence
1224 bases(100 bases per row)
GTACCTCTTAAGACGACCCACGTAAAACGTCGGGTGAGTCGTCATCGACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAG
GGTCCAATGAAGCGGTGCTTCAGCTTGTTGCTCTCGACCGAGCTAACAGTGTTTAGCGGTACGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAA
ACACGTTCATGTTTCCTCTTCCATTTCGGTCAGAGAAACCCTTCTGTTTATCTTGGGCTTGCGCCATGATGTCTCGCACCCTGCTGATTATGTTCAGCCT
GTCTTCGGCAAACGAGGACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACC
GAAGCCCCGGTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGCGCAACGCGTCCAGGTAAAAGGGCGTAAAGCCCGTCGATGCATGTACCGCACTGT
TGAGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCTTCGAGCACGCGATTGACGCGCTC
CGTCTGGCCATCCGTCTGCGGGTGGTCCGCCGTTGACATCGACAGTCGTGTGCCGAGAAGCTGAAACAACGTCTGCCAGAACGTAGCGGTGAACCGCGGG
TCTCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTG
GAGCAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCAT
CGACTTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACACGCTGGCACGTCTCGCACGTACGGACGTAG
GTGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCGAGATGGCCACTGGATGGAGCGTCGTGCG
CCTCCATCAGGATGTCGTACTTAAGATCCTCGTCGTTGGGCGCGACAGTACGGGGAGGATCCTCCGGCTCGACCCTATAGTGGAGCAAACCGTCAGCCCA
CTCATAGCGGTGCAGCCTTGCACG