Description :
From Genome Similarity Track
Location :
Scaffold_174:83064- 87177
Sequence
4113 bases(100 bases per row)
CCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGCAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGT
GATCCTCTCGACTTCGAACTCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAAGAGGACTTCGTCGAAATCCACGTGGTCGGATACATCCACT
GAAAGACGGATCTGTGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCA
GCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGTGGGCGTACCCTTCTTTCACTCGATCCAAATA
AAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCATTCCGCAGTCGTTCGTTCACC
TGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCA
GGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTA
CTCATCCCCAATCCCTTTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACG
ATATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCG
CTAGCACCAAATCTTCGGAAAACACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGATGCACTAGCTTTGGCAATCACATATCCGGTAAACA
GGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGTATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTT
GGATATTCCCAGGTGACTCCCCTTAGATTGTGGACCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTTTTGAATAGTCC
CCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGT
AAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGACAATAGAAGAGCAAGTCATTCAGATCCACTGCGT
AATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCTGACTAAAGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTC
GTCCTGTGCTTTGAGGATCCGCCCAATGCGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGACTGGATCCAATCCTTCCTCTGGACCTAGTGACC
GCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTTAACGTAGCGAGATCCTGATGCTCGGCCTCTGTCTCCACTT
CAACGCCGCATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACG
CAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAA
ATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAAGCCTTCCGCGTAAGTGG
ATCTGGCCCGTACAACTTCTCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGCACACGAGCGGATCCATCGAAACTCAAGAC
GTACAGATCCTCATCCACCTGTACCGTCGGAATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAACGCCCCATCCATCTTA
GCTCGAGGAGTGATGCTCGCGACCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCTAAGGCGAGAGTAAAGCTGCCC
ACTGTCCCAACCGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTA
ATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAATGTCCGGCTGACGAAGGTGACTGGA
TGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGATTGCCCAGTCACTGGCATAAACTATTACCGTAGGCTGACGTTCCGGATCGAAATGACGGA
GGATGGGCGTGGCCGCGATCCTGTTCCTCAGTTCCACGAATGCGTCTGGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTC
TATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCACTAGGACCCCTTCGTGGATCC
GACATCTCCCGGGCCAGAGCTTGTTGGAGTTTGATCCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCA
AACAGGGCGTAATCCTCGCTGAACCGACTGTAGTAGTTCAATCTGCCCAAGAAGGATTGCATCCGCCCGTAACGACTGTGGGAAGGAACAAATCGGCTAA
CGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTG
ATAGAGAGATTTCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGGTCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAG
ATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCGGATCCACCCTTTTCGGG
CTCCAGTATTCGAATGAATCCGTAGAGGGCGTTATCGATCAGGCGCTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAAC
AGTCCAAATGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTA
CTTTATCCAGATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTAT
ATCCACCCCGTTCTTCTTGATAATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCC
GATAGTTTTTCCCGGAACTGAGGTGCCACCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGC
ATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGCTTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCA
TCAATCGTGACTTCTTCTGTGGTCAGTTGTACCTCCGGGATCACCGCCATGCCTTCTTTCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGA
CTTGCTCATCTTC