Description :
From Genome Similarity Track
Location :
Scaffold_66:83020- 91311
Sequence
8291 bases(100 bases per row)
CACATGCACCTCTCCACTCGCTTTAGCCACTGCGATCACTTCTGACCTGCTAGACTTCAGAGTGATAAGAGCGCACGTAAACTTCAGCATATACAATAGA
TTCGAGTCTCTTGTCTTGAAACTGGAGGTTGCAGATCTCATTGCCATCACACCTGTGCTTGTAGTGGAGTGGCGCTATATTACAAGTACCGTACAATGCT
GATCTTGCGATGGGCAGCATTATACTCTGAAAATTTGCTCCGATACTAACGTGCACTTGAATCTCGACATGAATATGAATGAATCCAATGCTGACCAGGT
GCTAGTAACACCGGCACCCGCAGATTCATGCAACAACATGAGAGGTGTTAGCACCAAAACGCTGAAAAACTATAAACTTTTGCTGAACTTTTTTTGTTGT
CACTGGGATGAGACGATCAATGTACTGCAAAGTATGATTGAAAAGCAATTTGTAGAGGGGTGCTCTGTGTTTACCAAGTGACCAAGTGCACTAAATTTAG
TGTTGCAGTGATTTTAAGACTTCCAAACTTCACACACTCTATGGTAAGGAAGCAAATACTGCATCACACCATCAGCGCTCCACAAATCGCAGTCATGAGC
TATTGTTCGGCTTTCAAGTTCGAAGAAGCAAAACGTGACGTGGAAAATCGACTCGAATTGCTATTCAGCTGCAAGAAAACGTGCTCTGAATCAGCGTAGA
GCTTGTACAAACCACTTTTCATTCTGTTGAGTAAAAAGGTACCACAATGTCAGCTCAAATAAGGCAAAAACACGAAGAAATACAACCTGATCTTTGGTAG
AACCACTCAATCCGACCCAAAGCACAGCGCGTTTAAAACTCCTCGAGCCCCACGGCTGTCTCGCAATCGACAGTGTAGCAGTAATCGGAGCATCACGCCA
CACTTGAATACCATGTGAGTGCCCCGTCGTACTCCATAGCAACGATCCGTCGGCTTCATCTTTGCCATTCAACGCATTGAATCGCCTCCAGTTTACCGAT
CCTGCAAACCTGTGCCGACAAGAAACCTGCTGTCCCGCATTAGCCACAACGTTAGACGCCACTCCTGTCCCGACAGCCACAAGAGCCACAAAGAGCCACC
CAGCGCAGAACAAATACCCACCTTCTGGTTCCTCAAGTTGGTGTAAGCGCAGACGACGTGTATACCTATCTCTCGCATTCGGAGCCCCGCGTGAGCATCC
TGCAAACCCGTGTCGACAAGAAATCTGCTGTTCCGCATTATCCACAACATGATACCCCACTCCTGTCACGACAGCCACAAGAGCCACAAAGAGCCAAATA
GCGCAGAACGAATACCTACCCTCTGGTGCCTCAAGACGGCGTAAACGCAGACGAGTGTATACTTATCTCTCGCATTCGAAGCCCCGCGTGAACAAGCTGA
CATATGCGCAACAACGGTTTTTTTTCGCAGCTCGAAAAACACCCAGCTCATTGAACCCGTGCGCTTCAACAACAGCAGCCAGTACCCTCGATCGACCCCC
AAACGGTGCTCTGGGGTCACCACTGGCCGGGGCCGCGGGATCCAGCTTGCCCGGCGTGTAGCTGCACATACTTCCCACCCCTTCGCCATTTTCCAAATGC
TAGATCTCCGAAGGAGTAAAAATATGCACCAAATTAGACCTCAAAACCGCCGAACAGATTCTTTTCGTACCATATCTTCCACCACTAAACCCCAGATCCA
GTGCAAACGTATCCAGCGACCCCTTCTCTCCATGCACTTAGCAATGCGTTGAGCCGGCGTAGACATTGCGCGGACCTCCACATCGTACGTGGAGGCCGTG
CCCGCAGTGTTAACGGCCATTTTCAGTCTCGCAACGAGTCAGCAATCGTTGATGTTATGGTCGGCAAGGTCGATCCGGTCGACCATCCATGCAAAGTCAT
ACTCTACAGTAAAATCATCACACCACCTTTCAACTACGCACACCTCCAGCGCACCATCACCACGTTGACATGCCATGGAGCGCATGTGGATACCACAATC
GGGTCATCTTCACTATGGACAATAATGGCGATTATGTTCCAGCTGGCCTCGCAACACCCTCTACGGTGATTATCCACGGTGGTGTCGGCTTGACGGAGCC
GCTATCCGCTGGTTCAATGGTCGAGGCCATCGTTCATGGTCATGCAGCGGGCCAGTTGTAGACATTGTAGGCATTAACGCTCCTCGGCCTGTGCAACATG
GCACGGTTGCACTGTAGAAAATGACGTCAAAGTGGCCGTAGCGCGCCCAGTAGGCCGGTTCGGGTGGTGAATGGTATGTGGTGGGGTACTTCGCTACTCG
CCACGAGCTAGTAGCGTAGCGTTTTGCCTGATTTCCGTCTCTGGCCGCGAAAAATGCCGCCAATCCAGCGGTGGAGACGTTGTTGCATGGCAGGAAAAGT
ATCCTTCAAGGCCATGGTACCGTATTCTCTTTGGCAGTGCAGATAGACGGCGTTAGTGTGCTTTTTACTCGCATTTGTGTGTATTTCATCGTATAGGGCG
TGAAGGTGCTCACCTCACGTCGCCGCGTTACGGACAGGACTCGCGTCGAGTCTCTCCACCGTTAGTTCGTGCTCCGTTTCACGATGGTCCGTAGGTAGCT
CCTGTTCAGTCACGGCAAACCCAAATCGACTGTAAGTAGCAAGTTGAGAGCGTACTGTACGTGAAATCGGCAGTGTGTCACTGGGCATAGCAGGTCGAAA
GTGGTGGGCATGTGTTCTTTCTTTCCCTCACCTGTCTACAAACGGTAGCGCCGATTCGCAGACGTGAAGTGAGGAGGGCGGCGACTTTGACGTCGTTAGT
GGTAGAAGCCTAGACAGTGTCAAGGAACTTGCACTCTAAGCGGTCGTAAGGCGAACTGACAGCCCACGAGAGTCAGTGGTATGGCTCTTGGTTCTCTCCC
ACCGAGGGTCGCAGTTTTAAGAAATATGTGACGTGGTACGGGGAAATAATCTTTTGATACATCTGAATCAGATGATCTGATGTATCCTGCAGATACATGT
AGCCTTACAAACTTCAAATTCAAATACGAGATCCGACAGCTTTATCTCATTTCCTAGGTGGCCACATGTCGGGCAACAACGCTGTTATTGACGCTGGATC
GCAATCCTACCATCACCTATTCACTCCAAGAAAGCGTATGCAACTGAGGACGCCAAGCTGAAGAGTGAAGCCGATGCCCGAGCGAGGTCTACGCTGAGTA
AACAGGACTCGTCACGTGACCCTAGTAACAGTGAAGGAACAGCAAATACCGACTTGAGCGCTCTGCCTGCTTTTCATGGAGCTAAAACCTATGCTGCTTA
CATCGAGAGCAAGTTATCGTCTCGTGTTGCTGCAGCTAAGGACAAGGAGGAATACCTCGGCGTTATCCGTCTTGCGAGTGATGACAAGAGTATTGAAGGC
CTCCCCGTGGCAACACCTCCTTTCCGAGATGATGGCAAGGCACACATTGGAGTCGCCGCTACGGCCTTGTTACAGTTAAGTGTGGAGGATATCGCAAACT
CAAAGGAAGCGTACACAATCGAGGACGCCAAGCTGAAGAGTGAAGCCGATGCCCGAGTGAGGTCTACGCTGAGTAAGCAGGACTCGACACGTGCTGTATT
GAACCAGATGCGAACTGAACTTCAAGAGCTACAGGCACAAGACGCAGCGTTACCACCTCAAAGTCGCGTCGACTCGGAGGAGTGGGAGATTGATCTAGAC
TATGGAGATCTGTTGACTCGACAGGGCGATGAGGCGTGCGATGAAGTGCGCAATGCGCTTGCGTTTGCTGTGGAGAAAGAGGAGCTTCTACTGCTTAAGA
TGCGAGAGACGTACGTGGGTCCGCTGGCTGTAGAGCTGCTGACGTTGCGTGCGTTTGAAAGTGGATTAAGTGTCCAGTCCTTCCGCACCATGAAGATGCC
GGCAACTTTACAGAAACGACTCGCAGAGATCCACACTGCAGACGCTGCTGCCAAGAAGCAGCCATCTACTGGAGCGAAGACTGGTCCACCTAGACGAGCG
TCGGTATTAGATATCATGGAGAAGGACACTGCGCTGGACGAGGACTTTCCCTTAAAAGAAGACGAGCGACGTAAGCTCATGAGTCATAACGATCCTGCTG
TCGGCGGGAATTGCGCAGCATCAAGCGGTCCGACAGCAGTACAGGAGACTAGTGGGTCAAAGTCCGTTCACGGCTTCGAGGCGCGCAAACGACTGCGCAC
GGAGCGAAAGGAGAGACTGGCACGCTGGCAGAGCAACAAACCAGGCGAAGATGCCGACGATCCCAGAGACGTGGTCGCGATCGCCTTTGCTCAACGCAAC
ATGGGCGACTACAAGCTGAAAACGGCTGCAGACTACGTGGTTCCAGAACATCAGCGTGTCAACGCAGTGAAGAAATTGAGGCAGATGGCGCTCTTGGAGG
AGAGTCTGTATGCCGCACGCTTGCGCTTCAACGCCAAAGTGCTGGAGCTTCGCGAGTTGAAGGTGCAGCTGATCAACGAGCTGCATCGCGACCAGGAACG
ACTAGTCGAACTTCGAGCCGCATTAGCGTCCAGCGGCGCAACACCATCCAGCGTGTCGTCCAAAGATCTAGTTGTGGACCTTCGCGAGTGGCCGGAGCAG
CGGGAGCGCGTAAGCGACGCCGACATTGAGCTCTTCCTTCGAGGGCAGAAGGTGATATCACACGTGCAGACTCAGACTGGCGAAGCGCACTTGGCATTGA
CGCGCATCGGTGGGGCTGAGAAGCGTCCGCAATCAGCAGATCGATCCATCGCTGCCGTCGCACGAGCTCTGGAAGGAACGTCGGGAAAGGAGGCTGCAAA
GGGCGTCACCATTGGCCATTTACATCTGCAGATGGACGACGGTACGGCAGCTGCTGCGACGGCTTCGTCTGCACACGCGGGCGCTTTAAATGTAGAAAAC
ATGGACGAGGATGACGTGGTTGTCCATGAATACTTGATGCGCCAAGAGCTACTGCTCGAGCGCAAGAAGCAACGCGAGATAGCGTCGTTTGACGCTGCTG
TGGCTCACCTCCGTCGCGAGAAACTCGCTCTCGAGGTCGGCTTCAAGCAAGCGGAACTTCGGCTGTTCACTCTCCTTAGCGAGTTGTCGCTGCTTGAGTC
GTTCGAGAGCAAGGAAAACCTGTTGAGCAGTAAACTCGAGAAGAGTAAAGGGGAAAAGGCGCAGATTGTGGCGGACCTGCGCGATGTCCAAGACCTGCTG
ACGATCAAGAAACGCGATCTGGATGAATGGGCGCGACAGGAGAAGGCTGTGCAAGTAGAGTTCCTGACGCTTGTGAGCGGCGGCACGGGGTCAAGTGCTA
CACCTCACCCGAGCTTTGCGGCGCTGCAGAAGCTGTTTAAGCGCAAGATTAAGCGAGCTAAGAAGAAACCCGCTTCAGGTGGCAAGGAAGAAGGGAAAGA
GCCTGAAAGTGCGAGAGACGGCGAGGAGCTAGAAGACGACGATGAAGAAGAAGAGGACGAAGACGAAGACTATGACGAAGATGACGACGACGATGACGAA
GAAGAAGATGATACATGTCCGTCGGGATGCGACTTGACTCTGTACGAGAAGGTGTTGGCCCTGCGTGAGAAGCGTGTCGATGTAGACGACGCCATGGGGG
AGCTGAACAAGGCGATCGAAGAGCTTCGGAAGGCCGGAGAGCGTCAGACAGCCAAGCAGCGTGCGATCGACAAGGAGCTGGCTGCGACGGAGCAGGATAC
GCAGCAGTTCCAGAGTGAAAAGCAGTCGCGCTTCAACCAGCTGGACGTCGTAGTGCCGCTCCGTACGCGGCAACTATGTTGTCTTGAAGCTCCGTCTCCG
ACTCGGCAAAACTGGACGCTACCTGCTCAAGCTGCTGGCTGCCTCGTGTTCACCACTCGCGCCTTCTCTGCGTTGTCCGAGCGTATCGAGTCGCTGCAAG
CAGAGAACAAGAAGCTGCGTCAACAGTTCCGAGACCTCCACAAGCAGCAGAACGTGCTTGCTAAGGAGAAGCGTCAACAACAAGAAGCCATTGCAAGAGC
TCAGGACCGCAGCGAGCAGCTCATGCGACTGAAATTCGGACAGCTAGTGGACCTGGAGGTGCTGGATCGCGCTTGTGACGCGTCTTCGGTGGACGAGCTG
CAGACTCGCGTCAAGTTACGCGAGGTCGAAGGTGAGCGAGCGCTGCGTCGTGCCAAGCAGACGCACCCGCAGCTGTAACACGCTATTCTGCAGGCGACCG
AGCAGAACACGGCCTTGTTAGCTCAGATCGCTGCACTCACGGAGCGTCAGGCCGAACTGGAAAGCGAACTCAATCGCCATCAGGGTGATGGCAGTAGCAG
TTGGGACAGTGGCGGTGTACTCAGTCTTGACGACGACGAGGCCTTGGCTGAGCGCGAGATGAAGGAGCGCAACAAGCTCGTGCGGCTGGTGGAAGCTGCA
GGCCAGAGAAGTTGAAGCGCTCAAGCAGGAGATTGGACTGCTGCGCGGCAAAGATGGGAAAAGTGTATGCGCCTCGAGGGTAGAGCTTGGCGACGAGTAG
GATCCAGAGCGGTTAATACAGAGTCTTGCTCGATAGAGTGGGAGTGTGCTGATGGAGGCTAATAGTTATCTTGAGTGCAGCGCTTGAGTTGGCGAGGTCG
CTTGTGTGGTGGAAATCAAAACCGAAAGTGAAACGTTCGAGCAGGAAGACAAGACGCAGTCGAAGTCAAAGGTTTGTGGTGAAGAGATCGAGTAGAGAGG
TGCTTGTGCGCTGGAGCTCAAAACCGACAACGACCTTCGGTTTTGAGCTGCAACGCACATGCACCTCTCCACTCGCTGTAGCCACTGCGATCACTTCTGA
CCTGCTAGACTTCAGAGTGATAAGAGCGCACGTAAACTTCAGCATATACAATAGATTCGAGTCTCTTGTCTTGAAACTGGAGGTTGCAGATCTCATTGCT
ATCACACCTGTGTTTGTAGTGGAGTGGCGCTACATTACAAGTACCGTACAATGCTGATCTTGCGATGGGCAGCATTATACTGTGAAAATTTGCTCCGATA
CTAAGGTGCACTTGAATCTCGACATGAATATGAATGAATCTAATGCTGACCAGGTGCTAGTAACACCGGCACCCGCAGATTCATGCAACAACATGAGAGG
TGTTAGCACCAAAACGCTGAAAAACTATAAACTTTTGTTGAACTTTTTGTTGTCACTGGGATGAGACGATCAATGTACTGCAAAGTATGATTGAAAAGCA
ATTTGTAGAGGAGTGACATGTGTTTACCAAGTGACCAAGTGCACTAAATTCAGTGTTGCAGTGATTTTAAGACTTCCAAACTTCACACACTCTATGGTAA
GGAAGCAAATACTGCATCACACCATCAGCGCTCCACAAATCGCAGTCTTGTTCGGCTTTCAAGTTCGAAGAAGCAAAACGTGACGTGGAAAGTCGACTCG
AATTGCTATTCAGCTGCAAGAAAACGTGCTCTGAATCAGCGTAGAGCTTGTACAAACCACTTTACATTCTGTTGAGTAAAAGGGAACCACAATGTCAGCT
CAAATAAGGCAAATACACGAAGAAATACAACTTGATCTTTGGTAGAACCACCCAATCCGACCCAAAGCACAGCGCGTTTAAAAACTCCTCGAGCCCCACG
GCTGTCTCGCAATCGACAGTGTAGCAGTAATCGGAGCATCACGCCACACTTAAATACCATGTGAGTGCCCCGTCGTACTCCATAGCAACGATCCGTCGGC
TTCATCTTTGCCATTCAACGCATTGAATCGCCTCCAGTTTACCGATCCTGCAAACCTGTGCCGACAAGAAACCTGCTGTCCCGCATTAGCCACAACGTTA
GACGCCACTCCTGTCCCGACAGCCACAAGAGCCACAAAGAGCCACCTAGCGCAGAACAAATACCCACCTTCTGGTTCCTCAAGTTGGTGTAAGCGCAGAC
GACGTGTATACCTATCTCTCGCATTCGGAGCCCCGCGTGAGCATCCTGCAAACCCGTGTCGACAAGAAATCTGCTGCTCCGCATTATCCACAACATGATA
CCCCACTCCTGTCACGACAGCCACAAGAGCCACAAAGAGCCAAATAGCGCAGAACGAATACCTACCCTCTGGTGCCTCAAGACGGCGTAAACGCAGACGA
GTGTATACTTATCTCTCGCATTCGGAGCCCCGCGTGAACAAGCTGACATATGCGCAACACCGGGTTTTTTTCGCAGCTCGAAAAACACCCAGCTCATTGA
ACCCATGCGCTTCAACAACAGCAGCCAGTACCCTCGATCGACCTCCAAACTGTGCTCTGGGGTCACCACTGGCCGAAGCTGCGGGATCCAG