Description :
From Genome Similarity Track
Location :
Scaffold_115:8301- 10617
Transcript NameFunction/comments
Physo_158535predicted protein

Sequence
2316 bases(100 bases per row)
CGCTTGGCCCGGAGGGTGAGGATGTGTGCCGTATCCCCACGCAGAAGACGCGCTTCCTCAAGTACTACGCCCTGTATCTGGTAAAAAACCAATCTATAGC
TGGTGATGGATGATAGGGCTGCCTGCTAACCGTTATCGTTCATTTTAATGACTGGAGCAGGCGGGTGAGAAGGCAAAGGAGGAAATGGATCTGGAGATGA
ACGTGACAGGCAGCACCAAAGGTCCGTTGGTGGGCTTACTTGTTGTATTTGAGCTGCAGTCACGATGACTAAGTGGCGTGACTATCTCGTTGCTGAATGT
TGAAACAGAGGTGGACCGCAACTTGCATCGCCAAGGCACAAATCCTCACCTCAAGGAGCTGTATCTGTCGCTAAGCGCTGCCTACCAGCACAACTCGCTG
GACGGCTTCGGTCTCTATCTCTACGCTGTTGTTCTCAAGCGACTGGGCTACAGCACTAGCACTGGCAGTACCCAAGTCCAATCGTCCACCCCAGTTAGTA
TGAAGACTCGCCACCGAGCAGATTTTGCTGAGGAACGGCGGCGTCAGCAACTCCATGCCCCTGATAATGGTAGCAGCAACCAGGGACGCAGTAAGAGTGA
GACTGGCGCAGCACCCACGCTAACGTTTGACGTGACTACGCGGTTTATCCTGGTTGAATCTATTCGACGTTACCCGTGGAATTGGTCAGCTTGGATGGAG
CTAGCAGCCCACTCACCTTTCACATCCAATGTACGTCATAGTATGCTCGCTCACGTTCACGGTATCTTGCAAACTCTTAACTTGTCGTGCTGCTGTAGGA
GGAAGAAGTGATCTTGGCGACCAGTTGCCCCTGGATGTTCCAACTCTTCCAAGCTCATGTGCTACTGGACCAGCAGCAGAATGATGTTGCGCGGGCTCTT
CTGACAAGTTTGGAAGAGCAATTCCCACAGAGTACCTATCTGTTGGCGCAGCAGGCACTGACTAGCTACCACATTCGGGACTTTGATCAGTCGCAGGAGC
AATTCGAGCGGCTTGCTGCCCAAGATCCGCATCGGATGGAGAACATGGACGTTTATTCGAACGTGCTTTATGTGAAGGAGGACAAAACAGAGCTTAGTCG
ATTGGCGCACCGAGCACTCAAAGTGGAAAAGTACCGACCGGAGACGTGCTGCATCATTGGCAACTATTACTCGATCAAGAACAAGCATGACCGCGCCATT
ATCTACTTTCATCGTGCTTTGAAGCTGGATCCCAACTTTCTGTCGGCATGGACACTCATTGGCCACGAGTATATCGAAATGAAGAACACCAGTGCAGCTA
TCGAAGCCTATCGCCATGCAGTCGACCTCAACGTGCGGGACTATCGAGCTTGGTATGGTCTTGGGCAAGCGTACGAGATTCTCAACATGTTCCTCTACAG
TATCTACTACTACCGTAAATCGGTGGTGATCCGCCCGTACGACGCGCGCATGTGGTGTGCCCTAGGTGGGTGCTATGAGAAGCTGAATAAGGTCGACGAA
GCTCTCGCGTGCTTCCACCGCGCAGTAAACAATCAAGATCGTGAGGGTATCGCTTCCTACCATCTAGGGCGACTCTATGCCTCACGAGGACAGCAACATG
AAGCCGCCAAGTTCTACCAGATGCACCTCGGTCTTCGAAGTGTCACAGCATCACTTTTGCGCGATCAAGACGGCGCCAAGAGCTCCGTATCTGGGCGGAA
TAGCGAGGACGAAAGAGAGGTGCTCGTGCTTCCTGGTGGCAGTGGTGGAAATATCCGTGTCGATACCCCACAAGCGCTCGCAGCAATTTTGTTCCTCGCC
AACTATTACAAGCAGCTAGGTCGCTTGACCGAGGCCACAATCTTCTGCAACCGGTTACTGGACATGCAGGGGCCGGAAAAGGAGGAAGCCAAGGCACTCT
TGCGCGAGATGCACAGCCTCGAGGCAACTCGTATGCAATTCGCTTCGACGACAGAATCCTAGTGGATATGATCAGTCATATTTTGGTTACTATGGCGTTG
AAGAGACTAAAAAGCGGCACCGGTAAACCCGCGTATTCATCTTCTGTTGCTCCGATAACACAAAAGAACGATTGAGTTTGCCGATAACACCCCCAAAGCG
TTTCTTTTCTCCGCCTTGTGATGAGCTCAGCGCCACCCAAGATGCCTCCATCTTTCGTGCAAGCGCAAGAGCTGCATCGCACGCAGCAGACCAGGCATTA
TTTTGTTCTTCGGTAGGAGCATGGAGCTCTATTGTCAGCTCTTTCATTGCTTGCATCTGCTGAAATCCGATTATTTGCTCAGCTTGGCCCAGTGGAGAGA
TGCCAATGGCGATAGT