Description :
From Genome Similarity Track
Location :
Scaffold_138:83003- 84083
Sequence
1080 bases(100 bases per row)
AAGTACATTCTGCGTGTGAAATTGTGCCAACGGGGTGAAGCCCAGTCATTCATCTCGTGCGTCTCTACAGCATCTAGCAATCCCGACAGAGTGCTGGAAG
TCACGTTCCAATGGACTTCGTCTTCGGTTTCTCCGAAGAAGCTCACAAGAATAATGATATTCTTGTGTTCGTAAACCGATTCAGCGAGATGGTACATCTT
ACTGCAGTTCATGAGTCAATTTCAGCACATGGTTGTGCCCGTGTATTCATTGACAAGGTATTCCAACTCCACGGTCTACCCCGTGAACTAGTCTCCGATA
GATATCCTCGGTTCACGGCGACGTTTTGGCAATCCGTGCTCCGAGGGATCGGAACACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTGATGGTCA
GACAGAACGCATCAACCGCGTCCTCGAAGAGTTACTTCGAGGATACGTCCAATCTATCACAGATTGGAGCGAATTTGTGCCGATGGTGGAGTTTGCAATC
AACAACTCCGTGTGCATGCATCGATAACGCATACACCATTTTTTGTGAACGGCTTACGCCATCCACGCCTACCCACCCATTTAGAGTGTGACACTAATTC
AAGGGGGGGAGGGATTCGCTCCAGCAACAACGTTCTGGCTCTTGCTCATCACGTGTAGAGATAATCGACGACGCGAACGTTGCCGATTTCGATCGAGTCG
ACATCGAAGCTAATGATCTCAGCAATAGTGGCGACACTATTGCTGACCCAGATGAGGATGACGATGCTGGTATATTCAGCATCACCAATGACAACACCAG
AGAGGATGAGAAAATCCTCGCTGAAAAAGAGGATGACCTCCTAGCGGTGCGCACAAGGCGCACTGCAACAAACCAAAGTGATGCAGCAGAAGATTTCCTG
CTGGCACGAGAAGAAGTGGTTCGTTTCGTGTTTCGCTAACGCGGTGTAACGCGGTGGACCGGCAGAAACGAAACACTGATAAACATGGAAGAAAGAGCAA
ACTTTCTTCTATTTAATGTCGGAAACTTAGTTCTATTGTCTACGGTAAATCTACCTAAGCACGTAGTNNNNNNNNNNAAA