Description :
From Genome Similarity Track
Location :
Scaffold_137:830- 5935
Sequence
5105 bases(100 bases per row)
CCGTCTTTCAAGGGCGTCAGAATGCGGCCAGCCATCGTAGTAGAGCACGGGAAGGCAGAGTCCGATACGACGTTCATTCTCATATCCGGGCAGACCATGG
GATCAAATAACTTGGTGCGGAACCCGAGTGATGTGTCCAAGTCGTTATGCGACCCGGGGCAGTTGTGCTTACACCAAATAATGCAGCCGTCCGCTGCAAA
GCAGAGCGTCCCCGTGACGAAGACGGTATACAACCAACTGTTGTACATTGCATTTAGCAGGTCAGCGTTCGATAGCTGTTGGACCTGGAGTCTATTAGAT
ATCAGTAGCCTTGAATCCTTCTCGCAGAAATATAACTCATATAGCAATATGGTTTTTCCTTACTCTCAGATTCTTACCATCTATAAAGCCGAATGTATGC
TTTAAAGGGGGCTCTCGAGCTCCAACGAGTTTGGCAAGCTCAACCGGACGAGGAGAAGATAGCCACGCGATCCTTGCCGGAGCGTATCCCGTCAGGGCCC
TGGACAGCGTTTCCTCTGTACGCGGTAGGATTCTCGACAGTGTGCTTGATGGTACTCCGAACACCAAGCAAAGGGTGTTCTGCTCCATCGAGCCTACGTA
AAAGGACAACACGAGACCCAGAACTTGGTGGAGGTATTTTAGCTTAGGCGGTCGACCGCGAGTCGTGTGATGAGGGATGTTGTAGTAGCGACTGAATCGT
CGAAGGAGCTGGTGGAACGCCGATATGATGTTGTTCGAGTTAGACAAATACGAAGGAGTTTAGCTGTAAAACCGACTTACCTGTTCAAGCTTGTAGCATT
TAAGAAGTTGACGTCATTGCCGTACAGCACCATCCACGCCGAGTGACTCGGCGTGTCAAGGCACTGCGTAGTTATGTAGTGTCTGCTCCGCATGACGGTC
TTCCATGCCTCCTCCACTAGCAGCTGGTACACCTCTCGTCGGACCTAGTTCGGTGCCTTGTCATGACTCAAGAAAGCTTCGGTCAGCACCAGCGCGACGT
CCGACTGGTCGTCCACCATCACTTGAGCAAGACGCGCACAAATTCGGAAGTGAGAAGTATGAACGTGAGCGCGTCTGGTGATGCCCGAACAAAGTGACGG
ATACATTTGCTAATACAACAAATTATTAAAGCTACTACTGTACCTGATTCAGGGCAATGACATTCGGTCACAGAAATCAGCGGTATACTATTTGTGGTCG
ATCACTTTAGCGAAAAGTCAACATTTATCTTCTTAAACGCTGACATATCTGCTGCAGATAAGTCACCCGTTTAATCGATATTTGGCAGGCCTCCAGTGGT
GCGAAAGAATATACAACTAAGAAACAAGCGGTAATCGTACCTAATGTGGATTGGTCTGAGACATCTAAGTCACTGCAAGATATCATCATACATGATCCGA
GACTCATTTCGTATGTAGCCAATCAGAAGAAAAGAACTTCAGAGACATTCCCAGATTATAACAAACCGCTGGTGATATGGATGAATATGATAGTTTATCG
GACCATACTTATAAATTTGTATGGGTATATACTGGCAATTACCTGCCAGCAAATATCACCAACCAATCACAGCTAATCTAAATCATGATTTTAGCCAATC
GGATGCAGTAGGTATAGGTGAGTCATCCAAGCCACTCGATCGGACGTATCAACTCCGATAAAACTCTAAACTATGTGTATGTTCATTCAGTTGTCAAGAG
GTAGACGTATCACTTTCATATTCCTCTTTATCGGACCTTCGCGATGGGTTTGGAGGAATTGCAACCTGGCAACACATTGCGGGCTATGGCAACTGCTGTC
GCAGCATTTTCCAAGTTTTTAAAGGGTGAGGATGTTGAGGAGGATTACGTTACGAAATGTATTGAGGAGGATGAGAGTGGCAAGAGCTTTGTGTGCGTCA
TGGATAAGTTTGGAATGTATCTTGCGTTTAGTGAAGGAAAGAAGTGTAAATTGCTTGCACGAAACACTGCAATGCATAACTATCGCCAAGCAAAAATTTG
GCTCCTAGAGCAATTTCCTCAGCACCAAGCTTCACTAGAATCGCGGCTGCTTAAAATGGGAAAAACTCTAGATAACTCTTGTCTGAAAGAAATGGTGGTG
GCTTTGTAGCAAAGGCTCCACCATGTACAAAGGCTGATTTGAAAAAAATGGTTGTGTATTTGTATGTCAATGCATGTTCTGAGAGTGTCTACCAAGATGC
TGCTCTATGTGGCTGCTCTGGTACCTGTTCGGGCGAGCTTCGGACCTGTCGATGATGAAGAAGCGGAACATCTCTATAGATGCCGCCCGTGTCTTATTCC
TTCGCTTGGTCCGTGCGAAGACGTCGAAAGAACAAGGCTTGTATCTCTTCCCCGACGCCGACTTCACAACTTTCCCCTTGCTCGTTGTTGCTTTCGCCCT
CTCCGTCCAAGCAGCACCGTGTTCAGCTCTCATCGGGAACCTTCCTGACCAAGTGCAGCAAACGCTGACCACACTATCACCTGACGTGCCGCTCGTGAAC
TCCTAAACGCATCACCGGCGACCTCTGGTCTTGCTACACCTGGTCCTCCTCCTCCTCGTAGTGCTGCGGCTCCGACAATCTACGCACATGTCAGCCGTAT
GCTTGATCGCGTCGCCCCTGCCGCCGGTGTGTCAGCTGCTCTCACGTCGCACGCTTTCCGTCGTGGTGGGGCCCAACCTGCCAACTGCTGCGAGAAGATG
ACCGCGCGCTGGATCTTTGATCGCCGATCTTGGAACCTAAGCACCACAAACAAAGGGGTCAGCTACATCTTCAACACAAGTAGTGAAGACCGCATGATTG
CCAAGGTATTGAGTGGATACAAACCAAAGGACGTTGTCCCTCTCCAAGACCTGTCCAGCTTTGACGCCGACACGCTTGACACGATTGCCGAGTTCCAACG
AGTGTGGTTTGCAGCTTGCTATCAAATAGAGACGGAGAGGTTCAACATCAACCGGAAGGCTCTAGATGTCCTGACCGCTTGCGTCGTTAGGCGCTACCCC
GTCAAAAAGGGCTTGAATCCCAACAGTCCAGCCGTGCATCAAATCGAAACCTGTGTTACGCAGGCGGGACGTACGGTTACGGACCTCTTAGCCTGGTCGA
CGCATCTTGCAGAAGCGCAGCATTCCTGTAAAGACAACATAGAAGCATCCACCTCACCATCCATGCCAAAGAAACCAAGCCAAGAATAGAAGATCATCGA
GCACCAGGCCTCTGTCATTAAACACCTTATGAGAATATTCCAAGCGCCAAGACTCCCGCATGGATATGATTGAGGCTAAGCTGAACGGTGATCCTGTAGC
TGAAACGCGAAAAAGAAGCATTCAAGATGAAGACGCCACAGATGTGAGGAAACCCAAGCTAAAACAGCGTAGAGGATCAGCTAACTACCTTCATGCGACT
TAGTTTACCTGGTACGCGCAAGGGCCACGCTGGTACGTCGAAACACCGAAGTAGCAGCGCTCGAAGGCCAAGCTGCTAGTCGCTTACATGAAGCTTTCTT
CGACGACGGTTTCGTGCTCAGCCAAACCTCAGCGGACTACCGCGACCGAGTTCTGGAGCTGGGGAAGCGCGTCGAGAATGCCGTACTCAGGTACTTGAAA
GTCAAACACAGCATCAGCTCTCGCGGATCGAGCGCGGTCCTCAAGCTCCTCCAGCGGGTCCACTGCACCGGCGCGCCAAATGCTAAGTTCCAGCGCCACC
GCTAACTGCTCCAGACAGCTGCAATCCAAGACCCGTATCCTGGCTATACGCAGGACGTTCTTGAGGAGGTTAGTAAGTGGAACAAGCATTTAAATGAGAA
TGTATTCACCCTTCCTCACAGCATTAAGCTATGCCGACCTCAACACACTTATGCAGTCACCTTTCTTGCTGATCTGAGCTGTCCACGAAACTTGATCTTT
GCTACAAGGCCTCTAGCCCAAGCATAAGCAATAACGATGATCCGATTTGAACAGGCATCCTCAAGGCCGAAATTTTGCGCTCTTCCAGTTAAGCTACATC
GTTGGAAGGGGGGGGGGGTCAGAGGCGACCTGGAGGCTTGGAAGACCGTGCAGCCCGTACGGGAGATCAGCGTGGTTGCGTTGAAAAAAGTAAGACTGGC
CGCCAAAGTGAGCTGTCGGCGACGGATTGACTGAAAGTGAGAGGATGCAAAACATTTAATACGTGTATTCTAACGCAAATAAAAGTGGCACGTTTTTACG
GGCAGATATTTAACCAATAAGCAATAGTAGCTCTGATAACTGGCTGTCGCCAATCTTAATTTACCGGACAGATGCAAAATTATCCGGACGATCGTGGCGA
TTCTGCCTTATTGTTGAATATACTAACTCATACGCACGTGACTCTCATGCCAAAAATGCATAGAAAAACAAAATAGTGATTTTCTCAGCCCAGAGGGCGT
TTCAGGCCATTTCCTGCCGTCTATAAAACAGTCTGTTTGACCACTCTTTGGCCTTCAGCGTCATTTCATATCAGGCATGCCCTCCCCTAAACCTCGTACA
TATCTGCGATAAGCTGTGTACAATACATAGGTCTGATAAGGTCACCCGGTCCGATAAATTTTGGTATGGCAATTAATTAATTTCGGAAATTTTTGTCGAT
GGCTACGATATAAAGCCAATTCTGATACAAAATCTCAAAAAAGATAGTCATTTCACGAAGAAAAATATAGCGAACGATATATACAACGGCATACGAGCTT
AAATGTCTAAAACGATTTAATATCCGAGCGATTAAATGGGGAAGCAGCTACCGAGTTAAGGTTAGCGGTAGGACCGGTAAGATGGTGTATGCGAGAAACT
TATCGCGCCTCAAAAACTTAGAGCTTGTAGCGAAGCTGTACAAGGTCAGTCTCAAGCGACTGGAGAATATCTTATCCCCAGACTATCAAACTGACCCTCA
CTATCGCTTTTTCAGGGGCAACCACATGATTTCGCACCTATACGAAGGAACCCACCGTAGTGAGTTCTATGACAAGCTTCACCACGTTCTTGAGAGTGAG
ACAAGTGCTTACAAAGTTAGCATAACCCTCGGCTATGACCTTGTTAGCAAAGCAGATCATTCTGATTCGAGATACTTCCACTCAAATTTCAGTAATACCT
CTGTG