Description :
From Genome Similarity Track
Location :
Scaffold_1164:830- 4542
Sequence
3712 bases(100 bases per row)
GGCACTCTGATTGAATTCATACAGAAGCGCATCACAATTGAGCCTAACCACTCAGGATCGTCGTATCCTTTCCACTTGATCAGGTACTAGCGGAATCTCT
TGGAAGTACGAGTGCGCTTGGCCCACCGGAGGTCCAGAATCTTTTCCACTTCGTACTCATCATTCTGTTCGTCCGGCTCCCAGCTGTCCTCGGGCAGCAG
GGCTGCATCGAAATCGTCGTCATCATCCCGATCGAGTTCCGCGGTAGGTAGCTTCGTAAACAGAGCGCGAGGCTTGAGGCGGCTGATGTGTACCCAGGGG
TTAACACGATATCCTGTGTCCTCCACCTTGAGTTTCACTCTGAAGTCATCGTGTACCTCTTCGATCCTGAACGGCCCATGCCACATGTGAGCCAGCTTGC
TGCTCAATCCGGTCTGGACTTTCGGGATGTAGAGCCATACCGAATCACCTTTCTCAAATCCTGTCTTCAGCCTCACGCACAATTCTCTCCACTTGCGTGT
CTGTTCTTCCGATCGTGTTCGCTTCGCTTGTCTCTGGAGGTCCTCGGCACAGGCTATTGCGTAGCTGTAGTCGCGCTGAAATTTCCGACGCCACTCGTAC
GCAGTGCGTTCAGGCACACTAGATGCTTTCGGACCTAACATCGCCGTCACCGTGCCTTGCGCATCCCAACCGTGTACCAGATAGAATGGAATGTCCAATC
GGGTCGCGTCGAACGAGGTGTTGAGGGCGAACATCAGTCGCTCAGCGTGATCATCCCAGTCAGACTGGTCAGACTCAGCGATGTAAGCGCGGACGCTTCG
GATGACGGTCTGCACGAGTTCCTGTTGGCCGTTCGCACGATATGCCAACGTGGCGCGCTGACGACTGCCGAGTAGCTCCCGAAACCGAGTGAAGACCTCA
CTCATGAAACGTGGGTCTTGATCGTGTCTGATCATCGACGACGCACCGAAATTCCGGAAGACTCGCTCTTCATAGGCCTCTGCTACATCCTGTGCCGTAG
TAGACGACATGGGTTTACACATCACGTAATCAGAGAATGAATCATGAAAAAGCAGTAGGAAGGTGTTCCCTCGTGCCGACTTGGGCATGTGCGTCACAAA
ATCCATCAACACAACTTCAAACGGGCGCCTGGGCTCGATGTTACCAGGTGACGGTCCAGGGTTGGGAGGTCGCCCCTTTCCATTTGCACAGTCAACGCAC
TCCTTCACAAAACGTTCCACGTCGGCATACATGCCGGGCCAGTAGAACTCGGGCGTAACCGCTCGTGGGTGCGGGTAATTCCCTGGTGTCCACCTTGAAA
GTCCTCGTGAGCGTAATGCAGCAAGTCAGCGTGCAGTGTTTGTGGCACCACAAGACGTGGCTCATCCTGTACGTCCCGAGGTCGATCTCGAGTAGACCGC
GCGAGTCGATACAGGATGTCTCTGGCATCCAGTGCAAACAAGTCCGAGAGCTTCGCGATCTTGCGAAGCCGCCTCGAAGAGAATCGATCCAGGTCGCCAC
TCAGATACGCTTTGACTTCCGAAATGAACTCATCCTGATCTTGGTGTGCCTTAATCCTGCGCCACCTCTCGGCTTGGAACTCCAACGGACCCAATGGGCC
ACTCGACTCTGTCTGTTCCTGTGTTCTCGATCTGGTCAGGACCGCCATGACTCGAGCACAGTGAGGTAACGGAGCAGAACCGGGGTCCTGTTCGACATTG
TCTGGTGACCCCACATCCGGTGTCACCACCTTCTTAGCAGCCGATCCATCTGGTGCATCCTGAACTCCCTCACTCACATCCTGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCCTTCGACAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCG
TACGGGACTGCAGCTACCACCGGGAAATCCTCTATGAACTTGTGGTAGTAGTTCAGACTGCCGAGGAAGGACTGGATCCCCTTCAGAGTAGACGGGAATG
GTAGATCCAGTACGCCCTTAGCGATCTTCGGCGTCGCCCTGAGTCCTTCTGCACTGATCTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACT
CTTCGGTAGACTGACAGAGATGTTCCAATACCGCAACCGAAACAGTAGCGCATCCAGATCGATGCAAAGTTGATTCCACGTAGGCGCCCCATGCGCGATG
TCGTCAATGTACGAGCTCCGTCCTAGGACAGGGCCCATCTGCATCGGTGCCGGGATGTTACGTTGGAACACAGTCATCTGGTCTGTCAGCGCGGGTAGAC
GTCGGCCAGACAGGATTTCGTCGTCCGATCCGGTGTCGCTCCCTGCGACGTTGTCCTCTTGCGGCTTCAAACCCAAATAATCTAGTACGTCCTGATCCAC
CTGAGCTTCCTTACCAGGTGGTAGTCGAACAAAGCCCCACAGACAGTTGTTGAGCATCTGCTGGTACACCAGCGGAGCATTCTTCAGACCAAATGGCATG
CGTCGCCACTGGTAGTGACCGAACGGCGACACGAACGCCGAGATGAGCTTCGCTCCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATGTCCAGACTCAT
AAACCACATCGCGCTCTCGAACCCGATTAGCAGGTCGTCAATGAGCGGGAGAGGATAGTTGGACAACTGGATGAACCCGTTCACGATCCGGTAATCAATG
CACATCCGGATGTTGACCCCGTTCTTCTTCAGTACGATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTCTCCAACAACTTCT
TCAGCAACGCGTACACCTTCATCGCAAGGTGTGGCGCGACCGAGCGTGCCCTCTGTGCGACAGGCTTAGCGTCTCCACATCCAGATCGCAAACAACTCCG
CGAGCTGGGGCAGGTGCCGCATTTCCATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATGCCACGTAATCGGTGTTCGTCATCCGGCGTGCTCACGC
CAGGTTCGCCAACATCAGCCTTGTCAATGTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAGATC
GCTCCCTTCGTG