Description :
From Genome Similarity Track
Location :
Scaffold_1198:83- 5921
Sequence
5838 bases(100 bases per row)
TGGATCTGCTACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGAGGCAAGATCAACAATGAAAAA
GCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGACACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATT
GTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGTTGGCAGGTTGTTTGGTGTACTGGTTTGACATTTGGGTTGG
AGACCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAG
ATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGG
AACTGCCAGATCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCGGGGACCAGGTCAATCACA
ATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCT
GGATATGTGTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTATCGAGATTGAATTTCTCGGAGAAGAGAAGGCCCCGG
CGGAGCCAACTGGCCCTTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGATCCTACAGAGGGATCGTCGGATTGAGATCCAAGCGGTGAAGGTTGGA
TCCAAGACCGGGGATGATCCCCAGAGTCGGCCCCTAGATAACGCAGGATCGGTGGATGAAGGATCGCAGAGGGCTGAAGCCGGACCGCCAGATCCCGCTG
ACCCCAGAGTGGATTCTAGCTTTTCATGGGACCAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCGCT
AGAGAATCGACTAGATCCAACTGGTGGCTTCCCCGATACCAGGGTACCTGATCCCACGAAGACAGAACGACTGCCAGGTGAAAGAGGGTCGCGGTGCTTG
GATCCAATGGTGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGACCTACACGCCGAGGATCTCGGAAATGGCCTGGCGGTAA
TCCCGGAAGTACCACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCTAGGGGCAAACGAGCCCGCGGAAGTGGATCGGTTACGTCAGAA
AATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCCGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAGCCG
ATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTACTGCAAGCCAAGATCATCAGTTTCTCAACGT
CCCCGTGGGCATCTCCGGTGGTAATCATCATAAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTAGTTAACGGCCTGACTCGATTGAT
GGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACT
ATGACGGATCGAGCTTGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGACGAACGCACCCCAGATCT
ACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCAAATACCGGAACCCGAAAAGGGTGGATCCGGGGAAGATCATACGGAAGTGGATCCATTCGA
AGCAGGAGAGCCAGGGGATCATCGGACCCCGTCTGTGTTAGGACGCAGATTTTATATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTGTGC
GAAAGCGTGACATCCCTACTGGAGGCGTGTACTAAGTGGGATCTCTCTATCAGTGTGGTGAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCC
ATCGAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGCTAGCTGACTTGTCCTTCCCACAGTCGTTACGGTCGATGCAATCCTTCTT
GGGCAGTTTGAATTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCTGCGGTACTATATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACT
CCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCTGGAGATGCCGGATTCACGAAGGGATTCAAGTAGTACGACGCCAGAAGAGGACCTAAAACAGG
AGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCA
GCACGCATTCGTGAAACTGAGGAACAGGATCGCGATCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTAATAATTTATGCCAGCGAC
TGGGCAGTCTCAGCAGCTCTAAATCAAAAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGACGGACACTGAAGCCGAATGAACTGAACTACGGAG
CGGTGGAGAAAGAGATACTCGCGCTCATGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCT
AGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTCTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGG
GAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCC
GGATCCAGATCCCGATCCCGACGGTACGAGTGGATGAGGATCTGTACGTCTTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAG
TGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCGGCACCGTCAATGAAGCGGGGTATAGCGGGCTCCTT
CTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCGAATTTGGTAATCAGACAGATGCGAGGTGAGATTGACTGCA
AGGCCCCGGCCCTAACACTGCTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGTGAGATTGGAATGCCAG
TGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGAC
GAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGGTTGGATCCAGCCCCCAGATCCTCGGAGAAA
CATTTGTGAAGGGAGTCCGCATTAAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGA
CCTGAGTCGGGAGGATACCAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTC
GACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGTAATCTTACAGCAGGATGTCCTACACCACTATCACGCTAGTTTAGAAGGTGGACATCAGG
GTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCATTGGAGGGGACTATTCAAGAGCGTGCAACAATATGTCGGTGAATGTGTGGATTGTGAGAC
AGGCAAGGGCAGGCCCACGATCGAAGGGGAGTCACCTAAAAATGTTCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGAGTCCGAGTCCCCCCGATGGCTACCTATCATTC