Description :
From Genome Similarity Track
Location :
Scaffold_823:83- 4356
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_823-abinit-gene-0.12Kinesin-associated protein
Pytul_var.sporangiiferummaker-pug3_contig_823-snap-gene-0.9Gene of unknown function

Sequence
4273 bases(100 bases per row)
CGAGAAGCCCCGCAAGGTCACGGCTCGCGCTGACGAGCTCGATTCGTACATGGAGAAGCTGTACGACGAAGACATTGAGTCGAAAATCGACGGCGCCAAG
ATGATCCTGCAGTTGGCCGAATATGCTGGGAACATTGAAGCGCTGATCCAGAACGAAGCGCTGATGGTATGGCGTAGTGCTTGAATTGAGAGATGCGCTT
GTATGGATGCTAACGGTAGCTTTGTGTGTTTAATATGCCTGGCTCCTGGCTCCGGTGTAGTGCTTGTTGTCTCGCGTGCTCAACGACGATTACAAGAAGA
GCAACGACTTTTCGCTTACGATGATGCGCATCTTCTGGTGCTTTTCCAACTTCCTGCAATTGCATCCGATTCTCGCCAACTACCGCATTGGCGCCATCAC
GCTCAAGATCGTTGAATTCGAGATCAAACGCCACGAGTTGCGGGTCGCCGAAGAGAAAACCATGGAAGCAGCTGCGGTCGGGGACGAAGAGGCATTGGCA
AAGCTCGAGCGCGAGAAGAAGCGCAACAAGAAGCGCATGAAGAAACAGGATCAGCTACTGTACGTGCTGCTTGGAAGTTGAGACTTTTCCTCTTTCCCTC
AAACGTCTTTGTACTTCCTCATCACCGAGCCGCGTGTGCTTTTTGTTTGCAACAGGTACGTTTGCTTCAGCGTTCTCCTGAATCTGGCCGAGGATATCCA
CACGGAGCGCAAGATGGTCAAGCGAAAGATCACGTTCTTTCTGGCAAAGGTACCCATACTGTGCTCCTTCTCCTTATATCAAGACGTTAACTGCTGGGAT
TTTGTGGTTGCGAATGAAAGATGATGGATCGTGTCACCCCGGAGCTCGTGATCCTCACCATTTTGTTCTTGAAGAAGCTCAGCATCTTCGAAGAGAACAA
GGACACGATGGTTGAGCTCGTGGTCGTGGAAAAACTGATCCGCTACGCTCGCTGCAATCACGACAAAACGATCCAAATGTCCTTGAAGCTGCTCTTCAAC
CTGTCGTTCGATCCAGCATTACGCGAGATCCTCGTCAAAAACAGCCTCATTCCGAAACTCGTTGAGTTGCTGAAGAAACCTCCATTCCGTGCGCTTTCGC
TTCGTATTCTCTACCATCTGAGCATGGACGATCGCTGCAAGTCGATGTTCACGTACACGGAGGCGATCCCCATCGTCATGCAGCTTGTGGTACGTGCTCC
TCCATCCTTCTACATGCTCGGTGTATGTTGCTACTTTGGACACTAATTGCTGCTCTTTAATTTTAATTCACGCTTTCGCCACTCGTCGCAGATCAACTTT
CCACAAAACATGGTCGCAAAAGAGCTTGCAGCGCTTGCAGTGAACCTCAGTCATAATGGACGGAACGCTGAACTGATGTGCCAGAACCGTGGTCTTGAAG
CTCTCGTGACTCGCGTCTTGCGTACTCGAGACCCACTTCTCATGAAAGTGATTCGAAATGTCTCGCTCTGGTCATACAACCTGCAAGAAGACCTCACCAG
CGAGAAGATGTACAAATACCGAGGCATGTGGGCGCCTTTCATCGTCTCCTTCATCGAGCTATGCCTCAACACGGACAACCACGACTTTTCCATCGAAGTG
CTCGGCACTCTCGCGAATATGACGCCAGGAGATCTCCCCGCGAAAGCGTCCTGGGATCGCTTGATCACTGACCATTCGCTTATTCCGTTCTTGAACAAGT
TGCTCGTGCCTGGTTTCTCGCAAGACGATATGATTCTTGAAGTCGTCCTCTTCGTCAGTGCATTGGCGCTGGAGCCCAAGTGCGCACCACTGTTGTCTGC
GTCGCGACTCATCCGGACATTCCATTCTCTTTTCCAGGAAAAGCAGCACGACAACGAGCTCACGCTTCAGCTTCTGTACGCATTCTACCGAATGCTTCGC
CATCCAGAAACGTTCGATGAGATCATCTTCGGTGTAAGCTTCGTGCCAGACTTGCTGCTTGTGGCAGATGCTCCAAACATTGAAGTACGACGAATGTGCG
ACATCATCATGGATTTCATTCTCGACCACGATCTGAGCGAAGGCAACATCGGCGAATTTGGTCGCCTGATCCGTCAGCGTCGCTTTGAGATCCACAACGC
CGAGTATCTTGAGATGATCCACGAAGAATCCCAGAGCATGGCTTACCGAAACCGCGACCACCACATGATGCTTGCCTCGCACGATGACTGCAACGACTAA
CGTGTTTACGGTTGAGAGACACTCATACATCATGCATTCCAACATCCGTTATTCCGTTGATACATACACGCTTCATTACGAATAACGCTTTCTCACTCGC
CAGTATCTTTATCTAACTTAGAGCTCACCAAAAATGTGGACTTGATAAACCCATAGATCTGCTTTCGGTCCCTGAGCTCTCGTGGGAATCTGCTTTCAGG
CCAGTATAGGTTCTCTTTACTGTTGATTGACGCGCCAGGAGGGATCAGGTACATCGAGTAATTGCACGCAGGTGTAATGTTGAGTTCAAGAGCGAATGCC
AACGAAGGCGCTTTGTGACCGTACGCGGCGACCGCTCTCACAAGCTTCCACTGCTCAAATGCCGACTCGAGAGTGAAAAACGTCACGGTCGATTCGTGCC
AATTGCTAAGCTTGTCCTCCAACTCCTTGATTGGAATCTTTTTGCACTGCGTGATTACGAGATTTGCCACTGGAAACTCCTCAGCAGTTGGGATCGTCGA
AGTTTCTCGCAGACACCAAGTTCCATCCACGCGAAAGTCCTGAAAGGACGCACTGTCCACAACGTCAGCGATCCGTGCAAGACAGGACCAGTCGATCGGT
GGAGCTGCAGGCTGGAACATTGCACCTCCATCTAGATCAATGGGCATCTTTGCATCTTCGCCATCAATCGGTTCAGGATCGAGACCCGCGTCAATCAGAT
TTGCAATGTATTTGGCCGTGCGGCAATCTGCCAACGCTTTCGCTTCTTCTTCAGTGTCACCAACAACTCTGTACACCACATAGTCTCCGATTCTAAGCAC
ACAATGGACTCCACTCTGAGAAGGAGCATGCAATGAAGCCCGATATCCGTAATCGCGACTCCAAGATGGTTTCTCGATTGTGGTGGTAATCTGCAAGATA
AGACAACAGTACACAGAAATGAAAGCAATAAGACACTGAGATTCAAGCACGAGAGACAGAGATGGAGGAAGTGCTTACTGATGCAATATTCGCGAGGCGC
AGCGCTTGAAAGGATTCCGTAATATTCGAAACCGAAAGCTCCTTCATGTGGAAGAAATGGATCAGCTGAACCCAAACGTTGCGGATTTCATTCAGTTTCC
TCAGCATGCCGTCAATTGCGGCATTGCAAGCATCGTGTTTTGTCGCCTCAGCTGCTTTGAAATGAATCACGTCGTTCACAGCAACTCGAATTTCCAGAAT
TCCTTCTTGAAGGCGCTCCATATGAATCGTTGCTTTCACGTTCTGTACGATTTCTTTCTCCGCAGAACCGGCAAACTTTAGATGACCGCGTAGGCTGCTA
ATCCCGGCGCATAAATCATCGCTGATTGTGAATAAACTCCGCATCACGGCTCGGAGTCTTGCATCGTCTGTCTTGACGCTCTCTGACGACACATCATATG
GAATTCGTTTCTCCTTCTCCAATAAATCCATCAATTTCATCGCTGTGGCATCCGTCTGGCTTTTCGTGCGATCAATGCTGTCGCTCTTGTCAGTGGCTGG
TGCTCCCCCATAGTCAGAATCATCTGAGCTGTAGTCCGACTCATCGTCATCATCTTCGTCTTCACTGCATAGAACAAGATTGGCTGCCTTCTTCTTTTGC
GCAGGCTGGCGTGGTTGACTGGCCTCGGCTCTGGCATTCGGCACACTTCGTCGAGCACTACCACTGGCTGATCTGTTAGCATTCGAAGCCACAGCTTCAG
CCTTAATCTTCTGTTCCGTGACCTCATAGAACGATTCGAGAAGATCACGAAACTCTTCGCTTGCAGAGCGCTTTGCCATCTTTTGATTCAAACATTTGTG
GCGAATAGCCAACTGGTTTCGCACAGTGATATAGCATTCGTACAAATGCCCTGCGCGCTTCTCGACTAACTTGACCTGTTGTGAGCAACAACAACAATGG
TTACATAATGCTCATCATAACAAAGACTTTTAAAAAAAATGCTGTCAGGCCACTTACGAATTGCTGGTTCTTTGATTGCGTCTCGTTTCCTGCCATTAAA
GTCGTCCGTGTGTTCTTTCTGCGATCTCTGTACGTTCTTAGCAGCAGCTGCCAGTCCACGAATATTCGATCTA