Description :
From Genome Similarity Track
Location :
Scaffold_765:83- 2293
Transcript NameFunction/comments
g16691.t1hypothetical protein

Sequence
2210 bases(100 bases per row)
GCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCCAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTT
CGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGT
GAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACG
TACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCC
ACTGGTTAATGGTGGCGTTGTCGTACTCCCTGCGCTTCCATATCAGGACGTCTTCAGCTCGTCGACGGCGTCTGTAGACCGGATAGCCGTTCACATTGGT
CCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTCCCGCTCCACAGGGTCCATGCAGC
ATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGT
CCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTC
GCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCAGACCCAAGGGCCTCG
ACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACA
TCGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGCTAAGAAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGAC
CAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTACCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCGGTAC
TGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCAACACACCACTGCTGAAAGAGACGGC
CGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCC
GTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATATGGAAGCAGAAGAGGTACTGAAGCGGATCATACTCCGGGCGCGTCTCGAACAGTCGCA
GAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGATTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATT
GTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGCCGCTTGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAAC
TGCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCT
GCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTG
ACCCATTGCACCCTGGATGCGGTACGTGTACACACCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCG
CCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGACCGTA
AAGGGGGAAGACGAACCTTGTCTTCCAGACAGCAGCTTGTCTTCCAGACAACAGCTCACTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCAC
AAACAGTGGT