Description :
From Genome Similarity Track
Location :
Scaffold_3157:83- 1816
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_3157-abinit-gene-0.4(Fragment)

Sequence
1733 bases(100 bases per row)
GCCCTGTCCCGAGTCTCAAGACGCTGTGGACCCCGCAGACCCGGACCTTCGAGTTCACGTTGCTAAACGAGGCCATCGGCAGCGACATTCCAGTGGTCAT
CCTCGTTTCGGGCGTCTTCACTCCCGAGTGCGCGACCCCACAGGGTGAAGTCCTGGTCACGGCGTTCGAGAAACTGGTGGTACGCAGGAACACTGCGCCA
GTGTCCGCTCGAGGTGGACAGATCATCGACGGCCCCTGTCGCTTCGTGATCCCAAAGATCCTGCCTGGCCAGATTTCGGGTGCCAAGCGATGGTTGCCGT
TCAGCTGCTGTCCTGGGGGTACATCGGGTGTCTCGCTCAGCTTCACAGTGAACGGCGCGATCCCAGTGGGCGGCAAGATCCTGATTGAACTACCAGCGGA
CGGGTGGGACATGGACGACCATCCAAAAGCGCTGCTCCGCAATGCACAGCACCACAACGCTGTTGTCCCTGCGGTTTGGACGCGATTGCAACACATACTG
GAGATCACGCTGGCGAGCGGACCAGCGATCCCAATGAAGTCAAGCGTGACGCTCACGATTGTGAAAGTGACGAACCCGCCGAAAGAGACGCTCATCAGTG
CTGTGAACTGTGATCAGTCGTCGCTCACGCATAGTCACAGTGGACGCATCACGACGCTCGCTGCGAACGGCGGTGGCGTCATCGACGGCCCTTGCAAACT
GGACGTGGCGCGCATCAGCGAGCTGCGCGAGCCGGACTTTGAGATCGCAAAGGCGGGCTTTGACAGCGAAGATCTGGAGAAATGCGGCAACATCGCGGTT
GACAAGGTCGCGGATGTGCTCCGGCGTTGTAATGTGCACCTGTCGGACGAGCTCTACCAGTCGCTGGTGGTAGCCAACTTCCCCATTCGAGTACCAATGA
GATCAAGTGAGCAGCAAGGCGGAGAAGAGCCTAGTGAGCCAAGTACTACTGCTACTACAACTACAACTACAACTACCAGCATTACACCAAAAGCACTCCT
GCTGCTGGGTCCCGATCGCATCACACGGAACGAGTTCCTAAACCTGTTTGCAAGCGTGTATGCACCAGCGTACAAGTTCGGCCAGGAACTCCGACTGGCA
TGCGGACGCGGCCAAGTGGAGAAAGTGCGCGAGTGGGTCTCGCGAGGCTGCGACCCGAGCGCGAAGGACGGCTCCGGGTGGTGTGCACTGCACTATGTGG
CCGACTTTGGCCACTTGGACGTGCTGTTGACGCTGCTTGAACTGGATCAGCAGAAGATGACTGGAGGTGTGAATGTGGAGCCTGGCGCTGCTGCTACAAA
TCAATCTGCAGGTGTACAGCGAAGCCGTCGACTGGATTTGAATGTTCGCGACGCTCATGGCTGGACACCGCTCATGTGTGCTTGTGCGAACGGTCACACG
CGCATCGTGGAGACGCTGCTCAGCGTTGGTGCAAGCGTGTCGCTCGCAAGCAGTGACGGCCGCACAGCGTTGCACTGGGCTGCTGCGCGCGGCATGGACG
AGACGCTCCGCGTGCTTCTGAGCGTGCTTTTGAGCGCTATTGCTAGTAGCAATGGTGGCGAAGCTGCTAGCGATGGTGGATCATTGTGCATCGACACAGT
CGATCGCAGCGGCTGGTCGGCCCTGCATTGCGCGATGCTGCATGGCAGCCCTGGATGCGTACAGTTGTTGATCGAGAGTGGTGCGAATGCGAGTCTGAAG
GACAAGCTCCAGTACCCAGCAGCATACTATGGC