Description :
From Genome Similarity Track
Location :
Scaffold_2891:83- 1645
Sequence
1562 bases(100 bases per row)
GTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCG
CGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTT
CAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTCCTTAAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTG
CCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGATCTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTG
AATGTGAAACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGC
ACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGCAGTAATTAACCGCTCCAAGAAACGACTGCATGCTCTTCTTACTCGTTGGAAACGAAAGCTCGGTG
ATAGTCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAGATGCTCTTGGTGAAGCT
AATGCTGATCCGGACACTGTGCAAATCTTGCCAGCATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAAC
GACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGT
CTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGTCCACGACGTTCTTTGGCCTGTTCTTCAGCTAAACGCATC
CTCTCCGAGTATTCAATCAACCTCCTTTAGTTGAACGAACCCCCAGAGTGCGTGGTCATACTTACGCGGGTAGATACTCGGCGCTTTCTTTAACCCCAAG
AGGCCGGGTAAACCCTCCAAAATTTTCTAGTGGCCCGAGGAAGCGCGGACCCCTTTAGGCGCTCGCAAGGTCATCATGACCCGCCCCAGAAGCCGCTTGC
TGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATATTCCATGATCGCGGTGAAAGCATTCACC
ATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTTATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTG
CACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGAT
ATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCT