Description :
From Genome Similarity Track
Location :
Scaffold_2:829840- 831127
Sequence
1287 bases(100 bases per row)
AAGCGGTAACAAAATCTGACCCCGCTGGTAAATGGAAAGTTGTGTATCTGAATGGATCGACGGTGCACAACCATCCACCTTCGCAGGACGTTAGCTCTCA
CCCGGGACACAGACGCCGTGACATGCAGAAATTAATTTCACAGGAGCTCACAGCTGAGGGTGTCGTAGCTTCTCAAAATGCTGTGGGCATTTCGCCCCAA
GTTGCTGTGGCAATGTTACGTAAATCTCACCCTGATATTTTAGTCACTGCCAAGGACATATCTAACTACAAAAACGCTGAGCGTAGTGAAGAGCTTCGTA
CACACACATCCGTAGAGGTTCTACTGAAGCAGTTGGACAGCAACAAGTTTTATTCCGCCTACAAATTACATCCAGAGACTTCTCGTTTGCTGTATTTGTA
CTGGTCGCACCCTGGCATCATGAAGTACTTTCCGTGGAACTCAAACGTGCTGATTATGGACTGCACTTATAAGACCAATGAGTACGATCTTCCCTTACTA
AACATTATCGCCATGACGAGCACGAAGTCTGTCTTACCTGTCGCCCAATGTTGGTTACCTGGTGAAAAAAAAGAAGACTTTGTGTGGGCACTGACACATT
TGCTAAACATGATGACAGCTAATCACATAGCGCTCCCATCGATAATTCTTACGGACCGTAATTTAGCATGCATGAATGCGGTAGATGCTGTTTTTCCTGC
TGTTCCGTCACTAGTGTGTCGTTGGCACATGAATCGCAACGTATTGGCTAAGACTCGTTCAATTTTCGGTCAAATTCAAGTGGAAAACCCATTGCCCGAA
CAAGACAAGTTTGTAAATACCGTTGCCACAGATCAGTTTATGCAGCTCTACTACAACGCTGTTGATGCACTTACCGAAGCTGAGTTTGACGCAAAATGCG
AAGTTATTCGCGAAGCCAGCTCTGAAATGGCAGATTATCTGGACCTACAATGGTGGGAATACAAGACAAAACTTGTTCGCTGTTGGACAAATCAGTATCT
GCATTTTGGCTATCGTGATACCTCACCTGTTGAGGGAACACATTCTAAATGTAAGAAGTGGTTAGAGTCATCTCGAGGCGACTTGTTGACAGCCTTCAAA
AAGCTGCTACCGTGGTGGGAAGCCAGCATACAGAACGTGAAGTCTAACCTGGAGAAGGATGTCACGGTAATCTCTAATATTCTGCAAAAGCCTCAATATT
CGGGCGTCGTTATGTTTATCGGTCGCACCGCGTTAGACTCCACTGCGGAGTTTTGGAAACAAGGTGAAAAAATTGTGAAGAACAAGG