Description :
From Genome Similarity Track
Location :
Scaffold_32:82913- 87894
Sequence
4981 bases(100 bases per row)
TCACCGGAATAAGTCCCGTACTGGTGACAAGGCCTAAGGCGACCGACGTAGAATGTAGGATGCGTGCGCATCTTATGTGGCAGTTCAATCTTGTATGCGT
TGCCTAAGCGGCGCAGTACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGA
TAGTAGGACTAGGTCACCTTCATTGAATGAACGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCT
TGCACGAAACGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTATAGTGCGCCTGGAGAGCACTGTGGCAAGATCAG
TGACCTGGGTAGTAAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGT
ACGTGATGAGTGAGAGCCGAGTTGGCGTTCGCTCGAATGATTCCCTCCCCCTCAAACTAGAGTTGCACTCTAAGAAGGTGTGTAGGCGTGGGTAGCGCAA
GCCATTCACGAAGAACGGTGTATCCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTAGCAAGAATTCGCTCCAATTCGTAAACGAA
TGGACATAACCCCGAAGGATTTCCTCAAGAACGCGGTTTGCACGTCCTGTCTGACCATCTGTTTCAGGATGGTCAGAGGTCGATATCTGAAGGCGCGCTC
CGAGTGTTTTGAACATGGATCGCCAGAATTCCGCAGTTAACCGTGGGTCTCGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTC
AATAAAAACATGAGCACATGCCGATGCATTGATAGATTCAGGTACAGCTACCAGGTGTACCATTTTACTAAATCTATCAACGAACACAAGAATACCTGTA
TTCTTGTGTGGGTCTGCGGTGAATCCAAAGACAAAGTACATTGAGACTGATTCCCAGCATTCTGCCGGAATGGGTAAGGGTTGCAACGGCGCAAGAAGTG
AAGGACCTGACTCCACTCGTTGACATACTTCGCATGCGCGAACGTACTTTTCGCACGAACTGATACTGGCGGGGCCAGTAGAATTCGCGACTAACTGTGA
GATATGTCTTCTCTTGACCACGATGCCCACCAGTAGGTGCGTCGTGGTACTCATACATGATGCACAGTCGCAGGTCACTATGGTCCGGTACGACGACACG
AGGCGTGTCGCCGGCAACGGCTGAATACTTCAGTAAGCCATTGTAGACTGTATATCTATCCGTGGAGGATCGATATACTGGGGGCAAACTATTAAGGGAT
TGACGGGATGGTTGTGAGAGATGATCCATCAAACGCACCATCGCCGTATCGTACGCCTTGCGTATGTCTTCAAATAAGGTTGACGGCGGGACACTCGACG
TCAACACCGCGACAGTTGTCGGACCAGTGTCGGGTTGCGCAGCCGGTTCGAAATAGGGCCGGCGCGACAGAGCATCAGCGACGACATTCAGTCGTCCTGG
CTTTATTCCACGGAGAAGTTATACTCCGCGAAGAACGACAGCCACCTCGCCATTCGCTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCAT
GGTCCGTGTAAACGATGAAGGGTCTATCACCTAGTAGGTAGACTCTGAATTTTGCCAAAGCGTACTTCATGGCAAGGATCTCCTTGTCATGGACTGGGTA
GTTACGTTCAGCTGGTTGCAGCTGACGTGACTGATAGCGGACGACACGTTCAGCACCGTCTGTGTCATACTACATTAGTGCACATCCGATGGAAAAATCA
CTTGCATCGCAGATCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAAGGAGCGCTGGA
AATCAGCACTCCATGCCCACTTCTCGCTCTTTTTCAATAAACGAGAGAGATGAACAGTCAGCTCGGCGTAATTGTGCAAGTATTTGTTCAAATACGCCGC
TAGACCAAGGAACATTCGAAGTCCTTTTATGTCGGTAGGCACCAGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCGTGCCGGACGCCGTGCTTACCC
ACGATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATAAATACACTTCTTGAGGTTGGCATACAACTTATGCTCACGAATCTGTGTAAGGACTCTTCG
GACGTGGAGTCGGTGGACTTCCAAATCCGTCTGTCCATCCATAGCCCGGCTATGGAAGAACACGTCATCAAAATAGCTAGGTGCGAATTCTCGCACAGAT
CTCAACATATTTGTAACACATCTGTTGAACGTAGCAGGGGCATTACTCATCCCTTGTGGAATTGCTAAAAAACCACTCCCAAAGCATACCGCTTGGGTGC
TCACTGCTGTGTAAGGAATGTCCTTTTCACGCATAAGGATCTGATAGAACCCGTCCATCAAATCCATCGATGAAATGATGGTACTCCTTGCCACACCATC
GATAATGATATCCTTTCTTGGTATCGGCGTTTGAGCCGGTAAAGTTGCAGCATTCAACTTGTTGAAGGCATATACTATCCACCATCTTCCTGTGGCCTTT
CGGACACAGAAGCTCGGAGAGCTATGTGGGGAAGTAGTTTCCCATTCATGGCCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATGGCTAGTACTTGTT
CATGGGGCAATGTCCATTGCTTCATGACACAGTACTTTGAACCTGGTTTCAGGTCGAACTCGTGACGAGTACCCTTACCCTTGGGTAACTCGTACGGCAC
TGTTTCTGGGAACACATCTCTGAATTCCATCAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTATATCGCTCAATCCAAGTC
TTCTCATCAAGAACACTCTCTTCCATTGATAAGCTGCTGAGAACCCTTTCGTTATCAGCGAATACCATTGCCGACCGAATATCGGTTACGTACTCGTCTT
CCGAGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGCAGATCACGAAATAATCTCTTCTGTTCGAGCGTGGGTAATTGAGTGATCTCCGAGGTTGT
CTTCGGAGGCGCGATCAGATCAAGTTGGTAAGTGCCTATACTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTGTCTCCTGGGAACTTATTTCC
ACAGTTGGGTGGGGACTTATTCCCTCACTAGCCTCTTGGGCTATATCATCATATGACACGAGTGGAATTGCTCCCTGGTTATCTTCTGGCGGTGGTTGTA
CTACCGCGACCAGGTCTTCTACGTGCGATTCTCCAATCGCACTAAGATCATCGTATTGTCAATCATTGGCAATCGGTTCGTTGTCACTTGGGTGTTGTCC
TTTTGGAGGACACCTACGCCCCAGTCCACTCGACTTATTGGGTGGTGGGCCTTCGGCGCGACCTGCATCTCGATGCAGTCGCCGGTATCTGGCTTCATGG
TGTGGCAATCAGCCACTCCATGGCCATGTGCAGTCGTGCTAACGACCGGACCACACGCGAGGCCATCGCACTCGCTCGTAGTACACCCACATGTTAGTGG
GCGCTCCATGGCGTTCATCAGATGGCCATCTGATGAACAAGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGGATCGTACCTTCTGAGC
CACGGCAGTCTAGGATGACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTCATCATTATATTGGACTCCCTTCAGTGTATAGGTAATACCCACTAC
ACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGCCGCACCGTCATCCTTGTTGGAGGGATCTCTCGTTCAACATATTCGAGCTCTCTTTTGTCTAGC
TATTGGTGTTGTACAAAGTTGTTCGACGCCCCACAATTGACCAGAGCTCGAAGCGACATGCTTTTGTGTCACTTCGAGTTCCAAGGTAATGAGGTTTCCC
TCATTACCAGAAGCAGCAACACACAATGACTGAGTGTTGGGAGCAACTTTCTTCAAGAGGCCTGCAAACTCACTTGACGTTGCTGGATCAGTAGGGTGCT
TCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCCGTGTCCGTTGTTGCGTTTTCGAAACGACGTCGGACCCACGCCTTGGACCTCTCTTGGCCGCTTG
GCGGTTACTGTTTCCTGCGGTACGTGGTACCGCGCTCGGGGAACTGCATTCATATGCATAATGCCCTGTCTTCTGACATGTATTTCATTTTTGCAATTTC
TTTTAGTTGTTAATACGAGAGCTCTCGCTCCTCGCGTTCCAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGATGGACGATAGGAATTCG
AATTCGCGTGAGCCTGTTTCACGCTGAAGTCCTATTGTTCTGCAACCCTTATTGCCTCTTCCAGGGTGTTGAACTCCAATCGGAACAGGTAGGTTTTAAC
AGGACCATCAGTCATACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATG
CACGAGTGTACGTCACGTTTACCTTGCTTGATTTTAAGGAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGGCGGCTCAAAAGTTTGCCTCAGCAGGGACT
TGATGACTTCCAAAGACCCAAAGACATATGTGTCGTGTAACTTAAGGCCCAAGGACCACGTCTTTGCACGCTCTGCCAAGTTCGATTGAGAAAATGCGAT
CTGCATTTCCTCATCGACGATATGACGAGCCTTTATGTCATCGTCTAGTTCCACGAACCATCTCAACAGAGAGTCTTCATC