Description :
From Genome Similarity Track
Location :
Scaffold_16:82911- 87418
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08712hypothetical protein
Phypa_INRA-310PPTG_08713NPP1-like protein
Phypa_INRA-310PPTG_08714hypothetical protein

Sequence
4507 bases(100 bases per row)
CACAAGAGCTACCTGAGTGGATTAAGGAGTTCACCGAGCTAGAATATTTGTAAGTACCGAAATGCCAAGTGCCTGTGCATAATTACTGAATATTTTGCTG
ATATGTTTTTAGACATTTGGAAAGCAAGTTTACCAGCCCAATGACAGTTCTACCTGATGATATGTTCGATGACATGACGTCCCTTACGTTCATGCACCTT
GCAGCGTTCATGACAATGACTAAGCTGCCGTCGTTTGGAGGACTCAAGAACCTCCGATCACTCACATTAGCGTGTTTCCTGTCTATGGTCGAGTTGCCAA
CATTTGACAGTCTCCAAAATCTAGAGCGGTTAGTACTGGCATCCATGCCAGCGATGGACAGTCTTCCGGACCTTTCGGCTGTTACTGATCTCAAGTCGTT
CGCAGTGTCGGATCGAGGTGCTTGGTGCTGCAATGGATTTATTGGTACTTGTGATCTGGATGATCGTAAATGTGGAGTAGTGCACCCAGTATGGGGGAAT
CCCGCTGTGAGCTGCTTAGGGTCTGATCGGAATGAGAAAATAGCCACCGCTACAACACTTCAACTGGCCGGCAAGTTCTCGTCCACCATATGTGGACCTG
TACTCGAAGCTGGAGTCCTTGAGGGCCCACCGACTGAGAATCTTATGGCTCCATGCAACGGGACAATGTATCGACAATGTCCAAGAGCTGACAATGTCGA
ATCCATGTGCTACAACGCTCGGTTCATGGGGATTGCATGTACTACAAACCCGTACCCGATTGAAATGCGACGTCGTCAAATTGCCCAAGGAATTGGAGAC
TCATGTAATCCTCAAATTGAGGCGTGGCTAGGCTGCAAGTAGATACATGCAACAACAATAACTCGCCTATTGTAAACACCCAAAATTATCTGGATTTTAT
TTTTGGTATTCACAGTTTTAGGAGGCGAGTCATTCTAACCCAAAACTACTGTGGCTTGCCATACCCAATATAATGGGGTTTCCTTCTGATATTAGATACA
CGTGATTTTTGCTCGTATCGGAAGCAAGATCCTTAATTTAATCAAGTATCTCATGCCTTGATATCTCATTCCCTAGCACAACTCATGCAAAACTCGTGAA
TGTTGCTTGTGACGGCCAAGTGCAACATCATCGATAAATTACGGAAGATAAAAGTAATTTATTTCTGGTGAATGTCTTCCGAAGCTACGCTCAACAAGCA
GGATGGAAATTCGTAGAGAAAGGGGTAATACACATATTTGCCCATTAGCTGTAACCCGCTTGTATCTTGGTTTATCATAGTCCGCCATAAGCTCTCTCTC
TCTCGACGTTAAAATGCATGTTGATATGGTTACAACTGAGTGTACATCGAGAAATTTACAACATAGTATCTGTACGTTGTCGCAAACCAGAACACAAATA
CTTGGACAGCTTTTTTTCATGGAACCATATGCTTCTATTCAGTCTGGGTTTCAATTCCATTGGAGACAAGTGCGAAGCAACATCTACATGTGCAAAATAA
CTGTAATCCAAGTAGTGTTTTCAGCTCTACTCATTCTTGCTGAATGAAAATTTGTCCAAAACAACCGACAAAGGTATATCCTTTGAGGAGTTTGTCTATA
CATAATTAAATGCACAAACAAAATATTTATAAAATATTTATTTGGTGTGCTACAGGTCTGCGAAGTACATTACCCGTGGAAATTTACTCTTACTGCAAGT
AGTTCTTGTCAATACTCGACAGGAACACATTTCAAGTTGTTGCTAGGACTGCAGCAATACCAACAGTAAGATAGAATGAAAATTAGAGCTGCTCCGTGTC
AAACACTAGTATTTCTTATCATGTAAGAAAACTGAGCTAGACACTACAGCGGCCACGCCTTCTCGAGGTGGTCTTCATAGCGTTCGTCGCTGAATGGGAC
CTCGGCATTGCCAAAGTTGGCACTGTCGTTTAAAGCAGCACGAGCTGCATCAGTGAGTTGCTCCCACATGATCAAATCCTGGTACTCGCCATCCCACTCC
GCTAATTTCAAGAACGGAAAGCTCGAGGAAGGTAGCGCGTCAAAGCGGGGAGACGTGTTGGAGCCGTATACAGTAGTGCGGTTGAATCTGGTCCCTACTA
TACCGTACCCTGCAAAATTGGAAGGCCATATTTTAGTCTCCTTGTTGTACCACGTGTCAGACTTGGACATGGAGACTCCGACAATCTTAGGTGTCTCCAA
GTCGAGGTTGTCAATCCATACAACAACGTTCTTCCAGTCATGGCGTCTCGTGGGGAAATCCATCCAAAAGCCTTTCGGAAAGTACCAAGCGTACAGTATC
GCCCACAGGTCCTTGTAGCACCCCGCCCGACCGTAAACCTGGGAGCCTTTAATAGCAAATTTGCAGGCGTCGTTCCCTTTCGTCCACTTGAGTCCGCCAG
TGACTTCACCGACAGCATTTACAACAGGTACGGCACGCAAAGGCGTTCTGAATTGTACAGCTGGGGCTTGTACTTGACGGCAGTCTTTTCAGAAATCGTA
ACAGGCTTGGGTTGAGGAAAAGGTTGGATCTTGTCATGATCGACCGTCGCACTAGCACAAACAACCAGAACAACAAAAACTGTCGCGATAAGAGCTCGTG
GATTCATCTCGGCCGGGAGAATCAAAAAATGAACTGTGAGTGGCACTGGAATGATAGCTGCCCGATACTTTCTGAATGCATAGTGTTTTATTATTGGTAT
ACTAACTTTTTTTTTTACTTGTTTCCATGTATTATGATGATACGAGTTGAGATGGGATGTCCCGCAATCTTTGTCCAATCTCAAGAGTCCTGAGCATGCT
TCCTACAACGTACATTTTGGCGAAAGTTAACAAACGTACTCGAGCTCTTGTTTTTTTTTAATCTGATACTTCTACTGGATAGATTTTTTAAGAAGTAGGT
CTGATGTTGGAGTTGGTGCTTTGCATTACGGGACCATTGAGTGCTCATGGCCACCGACTACTTGACATCAGGCGGCAGCGTGCGAGAAACTAGCATGATG
TAGGTGCGACGTGGTACATCGGTACATCTCTCATCTTACATATCAGCATTTAGGTGCACTCGTCCTGTTACGTGCTCGCACTCAGAGATGGGAAAAATCG
TATTGCGATTGTAAAAGTGAGAGTGACTGTTTATGGCAATAATTGATTGGCGGCTCAACACAACCATCAAAATTGATTCTAGATATTGACCATCATGCAG
AGTAAAGCCATTCGTCACCATAATCTATGACCTGTCGTTTGAATTGTGTCAATGCGATTTCAAGCAGTATCTTCACTATTTTTTTTTTAAAAGTTGCACA
CTTTTCTGGGTACGTTTGATCACTGTGCACATAATCATTAGAACGAAATAGCAGCGTCGATGATCGAGCACATACAGCTTTCGACAATCTCTTTCTGGGA
GGTTTTTAGGTATTGCATAATTGATTGTCTTTCTGTAAAATGTATCATCAATAAACAACCCACAGCTCTGCCTCGTAGCCGTGGATCTCGATTACAATTT
GCTGCCTCTTGATCAGTAGCAACCTTCGACAACTAAGACTGAACCTTTCCGTTGCAGTGATCGCGGGACAGACCAAATTTGGCCTGACAGACTATGAATA
GGCTCGGCAAAGAACCTTGTCGTCGCATAAATAGCTCTGGAACAAGCACTCATTAGCACAGTGCCAACTCAGAATCCATATTTACTCAAGGTGACACCAT
GCAGTCGTTCCGCACTCTTCCGCCTGACGAAGACGGTGGACGCGAGGTATTCGACGGTCCTCTACAGCAGAAACACCAATCGAATATCACGCCTGCACCC
CCTCAAAAGATCTACCCAGGAGACGCTCCCGTGAAAAAGACAACTTTGAACTCGAATTCTGTCAAACCTCACCAAAATGTCGGTCATCCTGGAAAGAAAG
TCATGTTGTTCCAAGCGATGCTCGCGGTAGCGGTGTGCATTTGTCTTGGGTGGACACTGTGGCTTATCTTGTTGAACGTGGCGCCCAATGACACAGTGAA
CCGAGTCATGAACACGGAAACCTTCGACTACGGATCGTTCTGGCTGATGGTAGATCCGTCGAAAACTATGGTGGGATTCGCCACGTTTGGGCTCTCAGTT
GTGGCGCTAGGATACCTGGGTGTCTTCGTTAAATTGCTTATAACTCTCCGCAGTTCAAAGCAATTGTATCTAGTTCATCAACTCACAAACAAGAACTTTA
AAGAGAAAGTTGGGAAAGCTTTGCACGATGCCACTGACCAGCGGACCGGGAGCAGAGTGACGTCGGCTACGGCCCAGTTGGCTTTAAGCCTCACCCGTGA
AGACAGTTCTGCTCGAAAACGCATCGTACGTTGATTATATTAGTTGTGAGGTATTCGACGATATTCTGGCTAACTAATGGATTTCTCGTACAGAAATTAC
TGATGAAATTTGGAGATTTGGCACTGGAAACGCTACTGCTTTATCAGATGCTCGAAGGCGGCTCACCAGCACCTCTAATTGCCATATTTACAGTCGTAGT
CGCAACA