Description :
From Genome Similarity Track
Location :
Scaffold_347:829- 3550
Sequence
2721 bases(100 bases per row)
CAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTCGAACTGCGCAAACCATTGCGGAATCG
TACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGA
TCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGGGTACTCAAGATGTA
CGTCCCGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCTTTT
TACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACC
AAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGATGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCC
GCATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGG
GTGAGCGAAAAGATAGAAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCA
AAGAATATCCGGATCGGCCGCAGACCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTTCTCCTACCGGAAGACAGTTGGAATGTGGA
TCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTAG
CGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAATTGTGGATCATTGTGGTGAAGTGCTTTTCTCAGAAATAAGAGAATGGTCCTGACGC
GGGGTCACTATCCCGAATCAGTGACAATTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGCGAGC
AGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGCCAAGATCCACCAAGACTTACCTCGGGATCCACCCTTACCTGGATTCCA
CTAAGATGGATATGGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTGACGGTGGATCTAGTAGCCAC
GGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTCCTGAGTTCGTATCCAAGAAGGGAGGATCCCCCCTTGAGGGACCTGGATCC
AGGCTATAGGGATGAGGGATACAGTGGATCTCGAACTTTCGTAGGACAACGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATTGGAGAGTTCGGA
TCCCCGCCGAGTGTCCCACTACCACCCACCTCCCCCCAACCGACCCTGGATCCGGATGAGTGCACCCCATAATAGGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNN