Description :
From Genome Similarity Track
Location :
Scaffold_9:828903- 834427
Transcript NameFunction/comments
Physo_524301pol protein

Sequence
5524 bases(100 bases per row)
AGAGGCGAGAGCCAAAGCTCGTGAAGAGCGTGGGCGTGGTGCGACTACGTCTGCTACCGTGCCCCGGGTACCGGCCAAGAAGCCAAGGACTACTTACGAA
GCTGCCGCTGCTTCTCGTCCCATATCGCAACAGCCTTCGGGCAGTCTGCCTGAAGCTGCTCAACGGGCTCCCACGAGTTATCCGACTCAGGGTAACCCCT
CCACTTCACGAGCAGCTGGCGCTTGCCATGGAGCCGCCGCTCCCGGACGACTCGTTCCACGTGGTAGTGGATCTGTGGTGTAGTACCCCGCGGAAGAAGT
GGGCGCGCTGGGCGCCGGAGGAAGAAGGCGCCGGGACGCGAGTGATGGACTTCGACGCGGCTGATGGAACGCGACGCGGATTGATGGGCGCGACGCAGGG
CCGAGCTCGACGGGAAAGTCGGCGTGGGTGATGGGCCGTGAGACACGGTGCCAGAATCCAGTGCGACGCGTAATCATCCGACGGGTCGACCAGCGCACCC
GGTTCTGCAAAACGCGCCGACCCTAACCCCCGCCGACCAAAACGCGCCGAGGTAAGATCTTGATTGCGCCACGCAAACCAGGTTGAAGGACGGCAGCGCA
AGCACGACAGAAGTAGGGATAGGCCCAGAGCGGTAGGCTTAGCAAGCAGTAGTACAGAGTAGCCCGTAGCAAGGACATAGAATAGGGTAAGGACTCCGTC
CCGAAATTTCTCTGAACCACAAAGACCTCCCGTCTTCTCCGAGGTTCCAGGGGAACTACCAAGCGCCGGCAAGTAGAGCCGCCTAGATATCGCGGCCCCC
CGTCGTTTGCTGGTTCGGGTGCTCACCCCCCACAGACCCGTGCTGGAACAAAGGCACGTTGAACGTATACCGTTTAGGTGGGCGCCCGATAACGCGCTGC
CTAGGCGAAGGACCGCACTGGCCTGATAACCGCCGTGCACAAGACCCCCGTGTAGGCCCGATAACGCCACACAAGCCCCAGGAAATGCCGGCCCGATAAC
GCCGCACGCTCAAGGCTCGACGCCCTACGACAAGGAACAAGCGTCAACACAAGAACCCCCAACTCCGAAGCCTGCGAAGACTTGGGCCTGTATTTCGAAG
ATACGCTACTCCAACAACCGGGAATAATTTGCTCGGCGCGACCGCTATCCAGACGCGCCGAGTTTGTGCGAGATCGCATTCGCGAGATTTCTGCGAGAGC
GCTACTCCACAGATCTGCCAATTGCGATCAAGGAGGGCCGGCGGTGGCCTCGCACGGCCATGGCTACGAGCCTGAGGCGACGCAGCCGTATACTGGGGCC
CCGAGTCAGGTGGTGGCCCTGCAGCAAGAGGAGATTCGTCTTCTCCGGGACCGTGTGTACGTCCTCGAGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGG
CTGCCGCTCGTGCTGGTCAGTCTGGTGCCGTGGAGCGGCTCCGTGAGGATGTTGCCTCGCTCTATCAAGAAACTCGCAGTCTCCATGGCCGTGTGGATCG
TCGAGCCGACCTGTCGTCTTACGACTCGCTGCGTAACCAGCTCGCTGGCCTTCGGGCCGAGCTTCATGGCCACGCGCCGTATCCGGAGCAGCAGCAGCTC
CACTCGTATCAAGCCCAGTTTGGCCAGGGCTCGTACGACGCCCCTGCGTATGCTGCTCCGATGTACGCCGCGCCGTCTTACGACCAGCGCGCGTATCAGG
CGCCTTACCGCCACCCGACGCCGCGCTTCGAGGAGCTGCGCTCTTCTCCACCGGGCCACCCACCGCTTCCTGCGGGGCAGCCAGAGCCAGAGGGTCATGG
TACCTCTTAAGACGACCCACGTAAAACGTCGGGTGAGTCGTCATCGACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAGG
GTCCAATGAAGCGGTGCTTCAGCTTGTTGCTCTCGACCGAGCTAACAGTGTTTAGCGGTACGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAA
CACGTTCATGTTTCCTCTTCCATTTCGGTCAGAGAAACCCTTCTGTTTATCTTGGGCTTGCGCCATGATGTCTCGCACCCTGCTGATTATGTTCAGCCTG
TCTTCGGCAAACGAGGACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACCG
AAGCCCCGGTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGCGCAACGCGTCCAGGTAAAAGGGCGTAAAGCCCGTCGATGCATGTACCGCACTGTT
GAGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCTTCGAGCACGCGATTGACGCGCTCC
GTCTGGCCATCCGTCTGCGGGTGGTCCGCCGTTGACATCGACAGTCGTGTGCCGAGAAGCTGAAACAACGTCTGCCAGAACGTAGCGGTGAACCGCGGGT
CTCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTGG
AGCAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATC
GACTTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACACGCTGGCACGTCTCGCACGTACGGACGTAGG
TGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCGAGATGGCCACTGGATGGAGCGTCGTGCGC
CTCCATCAGGATGTCGTACTTAAGATCCTCGTCGTTGGGCGCGACAGTACGGGGAGGATCCTCCGGCTCGACCCTATAGTGGAGCAAACCGTCAGCCCAC
TCATAGCGGTGCAGCCTTGCACGTTGTCGGGGCGTGAGCCACTCGGCCTTGGCTTCCGAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGAGACTGGCAT
CGTCTCGGTACCCCAGCCTGATGCGATCATACAGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGACAAGGGCCGTGCCAGCTC
GGCGTAGCCTGCACTATACTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGACGTGGCGGCCAAGCCGCGATGGTTTTC
ACCTTCTCCGGGTCCGCCCGGACCCCGGCGCTGCTGATGAAGCAGCCCAGGACCTTGATCTCCTCAGCTGCGAACACACACTTGTCGATGTTGGCGTACA
GCTTGTTCGCCCGCATGACTTCGAACACACGTCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTGGACGAAGATGCC
GTCAAAGTACGTCTGTGTGAACGCACGCAAAGGTCGGAACAGTTGTGTGACCAAGCGATTGAACGTCGCCGGGGCGTTAGAAAGCCCCTGAGGCATGACC
AGCCACTCCCAGAGCATACCGCTCGGCGTGCTCACAGCCGTGAGTGGGATGTCGCTCTGGCGCATCAGGATCTGGTAGTATCCGTCCACCAGGTCCAGCG
CGCTATACAGCGTGCAGCCGGCCATGTTGTTGAGCAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGTTCAGCTTGTAATAAGC
ATGAACCAGACGTCACTTTCCGTTCGGTTTGCGAACACAGAAGGTAGGCGTCGAGTGCGGGGACTTCGACTCCCGCATCATGCCTGCCTTCGCCATGGCG
GCAAAGAAGGCATCAATGACTTCACACTGCTCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCGATCTCGTGCCTGA
TTCCCCTGTCCGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCGAACTCCTTCACCAAGGGGTACACCGGGTCCCGGGGGTTCTTAAGAAT
CTCAGAGCCCATGCGCGACGCGCGCTGTCTCTGGAACTCCTCCAGGACTGCCTGGTCCATGACCGAGGACGAGTTCAACTCGGCCGACGTGGACTCCGGT
CGGAGGAGAACCAACTCTGCGATCTCCCCGGCCTTTAGCTCGGCCAAGAAGTCCTCCATGGCGAGCTCCTCAAGGGTCAGCAACTCTGCAACCTCGGGCA
GAGCTGTAAGCTCGACAGCTCCTGTCTTGACCCGACGACCGGTCACGCCGTCGAAGATGTGATAACACTCTTCGGCGGCTGGAGCCTTGGCTGGAAGCTC
GGAGTCGCTGGCGACTGGCGTCGTCGGCCACACGACTGGGCCCGGCTTACGACGTGACCCTCGGGTGTCTTCGTCTCGTGGCGCCGCCTCGACGGCACCA
CCGATCTTCTCGATCTCGTGCGGAACGACGTTACCCGCCTTGTCCATGAGCGGAACTTGGTTACCCGCCTTGCTGGGTGGAACTATGTTACGTGTGGAAC
TTGGTTACCCACACCAGGAGCGCTTCCAGCGACTCCCGCATCAGTTATGGTCTGAGTGACCTCCTGTGGAACTATGTTACCCACATCGGAAGCGCCTGCA
GTGCCTTTCTCATCAGTTACGGTCTGAGTGACCTCGCGTGGAACTTGGTTACCCACGCCAACGCCAGCGGCGCCTTCTCCAGCAGCCCTTGCTGCCTGCG
GTACTTCGTTACCCGCGTGTGGACCTACGTTACGCACCTGGTAGGTGCTGTCCGGCACCTCCACTCTCAGGCCTTGTCCGGCCCGGTCGGAGTCGTCGTC
AGTCTCGACGGACCCCAAGAACTCATTAGACGCTGCTGCGCCCTGGCGGCCCTCGCGGGCGCCCCAGCTGCTGCCAGAGGTGGGAACATGACTCACCAAA
GCTCTGTCAGAGCGTGGGGGACGGCTGCCCCGATGGCCTTGCCGCGCCAGTCGATCCAAGGCTCGTGTTTCTCCAGCCACGGCATGCCAAGGATCAGGTC
GTACTTGTCCATGTCTAGGACCAAGAACGGCTCCGTGCTGTCGAAGTCCTCGAACTTGACAGTGAGGTCCATGTGGACCCGAGGTACTTCTACCACCGTA
CCGTCGGCCAGTCTTACCGAGACCAGCCCGTTGCCTTTGCTGCCTCGTAGCGCATCGGCGTACTTGTCGCGATTGCGTGCGACAGTCTGGCGGCGCGCAA
AGTTCTTGGACGCCCCAGAGTCGATCAAGATTCTCAAGGGATGATCGTATCCCGGTACACTCGCGTGCACCACATGCAGCCCACCGCTGCCCTGAGAGTA
CAGAGACTCTCAGGGGCTAAGTCCCCATGGCGTGCGCCACCCGCACGCCCCTCATGAAGACTTAGTGTTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTG
TCCGGCGTTCCCCTGGTTCCTGGG