Description :
From Genome Similarity Track
Location :
Scaffold_483:8288- 10262
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_483-snap-gene-0.9NOL1/NOP2/Sun family protein

Sequence
1974 bases(100 bases per row)
TGCTGCTTTTTACGCTTGAGCTTTTCCTTTTTCCGACGCTTGCGGGCGTCCTTTTGCGCGTCAGAAAGCTGTTTGCGCTTGCCACCCACCTGCGTCGCAG
TCTCCTCTTCTCCTTCTTCCTCTTCCTCCTGCTCNNNNNNNNNNCTTGCGTTTGCCGCCCACCTGCGTCGCAGTCTCATCTTCTACTTCTTCCTCTTCCT
CCTGCTCTGCACCTTCGAAGGCCTTTTCAGCCTGCACTGGCAGCGTCGAGAGCGTGCCTGCGGCCGTCACATCGCGTTCAAAGTAGGCTACAAAGAAGCC
GTTGGTCTGGTCCTCGTGGCCGTCGGCACGTACTAATGCATCCGCCTGCTCCGCCGAAAGACCCGCAACGGGGAGCCCTCGCCGCGGCCACGTGGGCAAG
CACTTACGCAAGACAAACGGCGCTGGGTCCCGCACGTTCTGCTCGGAACGCAGCGCCGCCGCGACGACCTNNNNNNNNNNGCGTACCACAAACGGCGCTG
GGTCCAGAACATTCTGCTCGGACCGCAGCGCCGCCGCGACGACCTCTTCGTTCTCCTTTTGAAAGATTGAGCACGTCGAGTACGACACGCGCTGTACCTG
CGGGAACGAAAAGGCCTTGAGCAACGCCTCAAGCTGGAAGTCGGCGAGCGACTGGAGCCGCGCGGCCACGTCCGCGTCGCCACTCTCGGCTCCGATCGCC
GCGACGTCGTTCTCCTGGGCATCGTCCTCTTTGAGCTGCGAGCTGGCAATGTCGAGCAAATGGTCCAGTCGGTTGGTCATGCCCGATCCCGAGCACGATG
GATCCAGCAGAATTGAGCGCACGTTCCGGTACTTTGCGTGGGCCACGTCGACCCCGAGAAAGCTCTGCAGACACGGCTCGACGAGCGCGTCGGCGCCAGC
GAGCTTCATGCGGCGCTTGAGTAACTCCAGGCGCTTTGCCGAGCGGTCAAACGCAAAAACCTTGCGCGTTGACGATGCCTGGGCGAGCAGCATGGCCGCG
TGGCTCGTCTTGTTGCCGGGGGCGGCACACGCGTCAATCACGTCGCCTTGGTCACTGGCGGTATCGGCACGCTCGCCGTGGAGCACAAACGCCGGAAAGC
AGCTGGCCTTGTCCTGCAAAATGAGCTTGCCCTGCTTCACGAGCGCGTGGTCGTGGAGCTCCGTGCCCGGCGGCAGCACGAGCAGGTCCTTGATGTGGGC
GTCTTCGCGAATGCCAGCGCTTTCAAACTCACGCACAAACGAAGCGCGCTCGTCGGATGAGATCAGGAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTTGCG
GTTCTCCTTGGGCAGAAGGGCCTCGTTGGAGGCCACCTTGGCCTTGATCTTGAGCCGCANNNNNNNNNNACGAATGCCAGCGCCCTCAAACTCGCGCACA
AACGAAGTGCGCTCGTCGGATGAGATCAAGAGCGTGTTGACGCGCACGTACCGCGGCAGCAATAGCTCGCTCTTGCGGTTCTCCTTCGGCAGAAGCGCCT
CGTTGGAGGCCACTTTGGCCTTGATCTTGAGCCGCACGAGCGCAGCCTTGAACGCGTTCGCAAACGGCATGAGCTCCTTCTTGACGTGGCCGCCGCCCTG
GATCTTACCACGACCAAAGAGCAGATCAAAGAGCGACACAAGCAGCAGCGCGCGTTGCGGCGACTCGCGCGGCAGCTTGGCGGGCCATTTGCACTCGGGC
ACGGCCGCGAGCAGCTGCAGCAGCAGCGGCTTAAAGCGCAGCGTCTCGCACACCAATGCAAACGAGCTGCGCTTGTGCTGCACGCTGTCGGCGTACGCGA
GGCTCTTGAGTCCGCCCTCGCGCCGCTCGAGCTTCTGCAGCAGCGCCGCTGCCTCCTTGTACAGCTCGCTCATG