Description :
From Genome Similarity Track
Location :
Scaffold_53:82874- 84169
Sequence
1295 bases(100 bases per row)
CCTGTAATAATGGCTTTCGAGACTTTAATCATGGGACAGCGGGCGTTAATTGGGTAGCGACCGAGAGAATGACATTACTCTAGCATGACATCCCTATCCA
CTCTAGAATTACATCTCCACCCACTAGTCATCTTTATCATTAAAACTAACCCATCGTATCCTGAGATGTATCACGCAAAGATGGCAGGATCCTAGTCTGA
TAGAAGCAAACATTAGTAAAAACTCAGAAGTAACATGTATGTTGTGAAAGCGAGCTAACGACCTCTCATAAATATGCAACTTCGGTATTTACCTGTGAAC
TAGCGGAGCCTTACGATTATATAATACACTTGGTCTCCTTTTCGATCGACAAGCGAAATTAATATGTAATTGCTAAACCACCGGGACCTTAACAAGCTTC
CAATCAAAAAAGGGAGCTGCAACGGGGCAACAGTACTCGTTACTAATCCTCCAACACCTCCATACATTACTGCGGACCCGAAGGGTGAAGCTGTTAGTGA
CTGTGCGCAAAGTGAATGCCAAACTTTTAAATCCTACTTTCTGTCTGTCTGTCTGTCTGTCCGTCTGTTTGTCCGAAAGTAAAGCTAGGTGTACCATACA
CGTCGCACTGCGTGCGATATAGCCTGTCCTATTCTTATAGGTAGGTAGGTATACATCATAGGTTACTCTTTAGGTGGGTCACTAATTACGACCGCGTACA
GTGTTTATCACCCACACGCACCAAGGCCCGCACGGGATTGGCTTGAAAGCGATAAAGGACGAACACAAGGCAATTAAGCAAATGCGGAAGTCTCGCACCT
CGGGCAAACGGCAAATGTGAAGTGTATTTCGTACGTAGTACTTGATCAATTGGAAAAGTATGAAATGCTAGTAACTTACTCTCCCAGTGGCTGAGGATGC
TCCCTTGATTTATTTCCCTTTCGCATTAATCAATGATATGTCGTCGACCGCACTTTGGTATTAACAACATTACCAGTCAAGATCATATTCTGTCTACCGG
ATCTCATATTCGTCTCTTCGGAAGATTAAAAACACCAAACGAGTAACTTTAACCCATCAATCCATCAGCACTTTCATAATAACACACCCAGCACAACACA
TTCCCCAGCCGCCAAGCATCTTGGAATGGGTAAGTGAATAGACAGAACTTGATTCAGTTCTCTGGACTAAATTACTGATATCAAAGGGTGGTCTCCAGAG
CTTGCCCCCCATCTCTTTCCTAAGACGGATTTATGTCAATACTCGAACAACTGGTTGGCACGGCAAACGACGCCCGTGATGCATTGGACGATCTG