Description :
From Genome Similarity Track
Location :
Scaffold_115:8287- 11795
Transcript NameFunction/comments
g2588.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
3508 bases(100 bases per row)
CTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTCGCGCCGAAACGTC
GAAAGACGCATTCTTCGTAATTCTCGGCAATCGTTTGGGCCGTGCGAGAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAGATTAA
CAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCGATTCT
CCCTGAATGAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCT
TGACACGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATGCAGGACGTCTTGTTGTAGCGTCTCCGGGATGACCAG
CCGCGCGAGGGAGTCTCGGTCCTCGTCCGATCGCGGTGTTGTCGGGCAGTAAAGCAGAAGGCCGCTTTCGTCCAGCTCGTAATCGCAGGCGGTCTTGGCG
CAAGACTTAGCGTCGGTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATATTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCC
GTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCTCGGCACTCGTCTCGACCGTCGTGCCGATCGCGTCACCGCTGATACACGAGCTACAGC
GTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGA
AGAGCTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTCGGCCACGATCGGAGCCGATCCATCGCTTTCT
CGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCCCTGTC
CATAGTGGACAGGAGATCGAAGCACAACAACAGTCCGCGATACTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTC
CATCCCGGCAGCCTCCACACGATCGCACTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGTTTCATCCGCTT
CGACCGTAGGGGGTGGCATGGTGATCGTCAGCCGGGGCTGCTTCACTGGGGCAATCGCGATCAACGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGC
TGCGATCGCTCCCAGAATTTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGG
AAGCCAGCCGAGTGGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCA
GGAGTGCCAAGACTTCCTTGTCGACAATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTC
TTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATC
TTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGGCCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGGGATGG
ACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTT
CAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACG
GACACTCGGTGTCCCAAGTAGTCTACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTT
CAACCTTCTCACACAGCATGTCCCAAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTCGGCTCTGGTTCTGG
CTCGCCTGAATCGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGCCCATACAGCGCGTTATCAATCACTCGCTGGTAGATC
TGTGGCGCATTCTTTAACCCGAAAGGCATACGCGTCCACTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCTTCCGTGCGCGTTCTGTCATGGAGA
CTACCCAAAAGCCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGGTACACCATCAG
TCTCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTC
GACGGCGTGATCATCTTCGCCGATAACAGGCTTTTGATCAGATCCGACAGCTTCTCACGGAACTGTGGAGCGACTTTTCGGACACGTTGTGCAACAGGAG
CTGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCAGCTGGTGGTAACGCGTTCCCCTTCCCGATCAGGAGATGTTTCCGCCTCCAAATTATCTG
TCGCAGGCGATCGATTTCTTCCGGGGTGTTTGACTCAGCATCGCCCACCTGGATATCCTCGATCGTGACTTCATCGGTGGTGGTCACTACTTCCGGCAAG
ATTGCCATCTGTCTCTCCACATCTTCCGCGAACAGGTCGCCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATTAACGATCAGAGGCG
TTTCGGCCCGGGGCACAGACTCCCTCTGGTCCGCAGTCATCTCGTTTCGTGTGGCCTGCTCTATTGGCGGAGATTCTCTCGCGTCCTGATCGCCGGTGCC
ACCTTCCTGATCCCTTGGAGACCCCTCAGCTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATTTCGAGGTTCCGCGGTCA
CGACGCAGGATTTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGAGCGAGTTCATGCTCTTCTACCTCCACATGGTCTGTAGTAG
ACTGGAAAGCTAGATTCTGCCACTCGGCATACCTGCGCGATCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCACATGCCGAC
ATGGGTGT