Description :
From Genome Similarity Track
Location :
Scaffold_80:82868- 86333
Sequence
3465 bases(100 bases per row)
CATCGAACCAGTACACCAAACAACCTGCCAACGTGACCGTGATTCGCGTTCTCCCGTTTGTACGGTACACGCCTTCATCAATCCCAACACAATCTTGGAT
CCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATGGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTCGATTG
ATGATCTTGCCCCCTACCTTGGCTTGCCTGAACCACTTTCCTGGAGCATGGTACTTTCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAA
CATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGGGGACTCGCAGTGACCTCACCCTTGGTAGGCCCAAACCATCGACCATGTTGGCGTTT
CTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGCAGAGACTTCGGATCTGGCAAATTGATTCACTTGGCGCAAACTAGAAATCTTGGCA
ACTGACACTTCATGCAGATCACGTGTATTATCGACTGGATCTAAGGTCCCGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACC
TAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATTA
AACCACTGGCGGATCTGGTTGTAGAATGCCTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAGCCGCGACACACGTAGAAGCAATGATCTCCGG
GATGACCTTTCTTGCCACATTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCGGTGTGCTTCCGGGATCCGCATGCGAACACCTGACTTGTGCGGTC
CCGCCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGAGTACGGTATCCCCCGACCGCGAGTTGTCTTCGGTCTTCGCCGTTCGATCGTTGGATG
CTGTGAGACAGACTCGACGGTAATCCTCTGGGTCGGAGTCCGAACTGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGTCGTGACTTGGTAGACACGTCG
AGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACTGCCGCTTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACT
TCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCA
GTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCA
AGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTTCGCAACAAATCTGGTCACTTGTTGTTGGTGGATATGCCC
AGCTGCCGATACCAATTTTTGGCTGGCCCCGCTTGCAGACCCGCAAATGTCAGACACTTTTCATCATCCGACGCTTGATCTCTCATGAGGGCCAACTTGA
CTTTGCTGATCCATGTTCGCGCTCGGACTTCGTCTTGATCCTTGCCCGCGAACTCCTACACATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGA
CGATCCATCCGTCCCGGCAGCAGCTGTTGCTACCGCCGCTGGCGAGAGGGATGGGCCATCCAGATCATCTGGGTCGAGCTCATCATGGGAGTTGTTTCCC
TCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTGTTCGGCCAGGAAACGACTCA
TCGCAGCTTCGGAGTGTCGCTGCAGGGTGCCTGAGGAGGTGTCGGAAGAGCCTGTGGCCGTCGGGTCCACTGGCGAGTCAGGATCTGTACGGCGATTACC
TTGAGTCCGATCTAACGGTAACTCCCCTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGCGGGGCGTACTGGATCCCGA
GCCTTCACGTTCACAGGGGCTTCCTGTCCCCGGATCCTCGCCCGTGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGGGGCTCGGACG
ACGTGTCGGACCCATCTTCCGCCGCAGATTCGTAGTTCGGGGACACAGCTTGGCTGATCCTCGGTGACGACACTGCATCCATAGTGTGCGACCTTTCTCC
GGTGATGGACTTTACTCTGACGAAGAGGTCCCGCGTCACTGATACTATGAGATCTAAATCCAGCTCGAAGATATCCTCTGCATCGAACGCTCCTGCCACG
ATGCCTGAATCCTTAAGCAGACGTAATAGACCCTTGACCGCTACCAACGTGTTCGCCGTTTTTGTTGGTGCTTTCACCGGTTCCCTTGGATCTTCGATCT
GTCGTGGATTCAGGATCCGCATGACAGGATCTTGATGTAGAATGTCGCGTAGAGCTTGGTAGTGATACAAAAACTCGAGGTCCTTGTCGGACAAGCTTGA
CCTGAATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTGTTCGTCTTCTTTCTCGTTTTTCGACTAGCGGGC
TTGGGTTTACGTACGGTGTTGGCTTAACCAGTGAGTCTGCAAATACATACCGTTTTGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACGCAAGTC
AAGATCCACAGGGGCCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGCTCCTCCCAGGA
CTCCAACGATCCGCGGATCTTGCTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTT
CTTGGGACTCACGGTGACATCCCGAGTCGCCAAACGATCCGGGCACGCGCACCATTGTGATGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGTATCCA
ACTTACCAACAGCGCCCAGACACCAACTAATGGAGGGTCCCCCGATGATCCGTATTCTGCTGAACTTTCCTCACCTTGTGTACCCGCCGGTAGGGCGGGA
TCTTGCTCTCTCGGTAGCTTCCGGAGAGCTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACT
CTGCGTCCGTGGATAGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGT
CCCTTGCCTTTGCGTTTCCTTTTGCGTTGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG