Description :
From Genome Similarity Track
Location :
contig_11:82840- 83880
Transcript NameFunction/comments
g3027.t1RAW21654.1 hypothetical protein PC110_g21903 [Phytophthora cactorum

Sequence
1040 bases(100 bases per row)
ACAATAAACAGGTAAATTGATACACAAACATCACGATATGAAGTCTCATCACGCTACCATCATTCACATTTTCGATGATCGAGGCGGCCACATGGTGATA
CAGGCGGCTGAAGGCAACGAAGACAGGTAGGTGCATGTCAGGCCCGCTGGGAAGCCTTGGTCTCGTTGTCTCATTTTCCAATTCGCCCTCTGAGTGGCAT
ACCTGCACCACCACCAAGCAAGCTACTACCAGGCCCAACCACCGCGCCATGAGCGACGCCACTGCGACGCCCCTCAACCCCACGGACGAGTTCCTGCGCA
ACCTCAGCACGGGCTACGTCGTCCTGGACGCCTTCGTGTGTCTGCTGGTGCCGCTGATAGTGCAGCAGCTCGTCACGTCCCTCCAGGGCTCGGGCGACTC
GCTGCTCAGCCGCCTATACACCCTGCTCTTCAGACAGAAGGAGCCCGAGGGCGTGTACCGCATCATCGGCATCACGCAGCGCTTCAGCTCCGAGGGTCAC
AAGATCTGGGACTACGAACAGAAGAACCACTTGCTGCAGAAGGCCATCTCGCTCTACCTGGCAGACGTACTGGATCTGACCAACAAGGACGCCAAGTACG
ACCTGCTAGATCGTCCACAGAAGAAGAAGAAGGCGGCGGCGGACAGCGATGACGACGGCGACACGAGCGAGTCTTCATACGAGTCGGAAGACTCGGACGC
GGGCTACTGCGGCGCCGTGGACGGTCTGTGCTGGGAGGCGCTTCCCCAGGAGAACGAGTGGATCGAGGTGGAGGAAGGCATCCAGTTCAAGCACGAGACC
GTCGAGCCCGAGGACACGGAGGAGAAGAAGACCAAGTCGCTCACGGAGACCAACGTCAACTTCAAGTTCTTCTCGACACTGCCCGATGGCTCCGAACGCA
TCGACGCGCTCATCCAGCGCGCGTTCAAGAACTACCAGGAGATGGAGCGCACGCGGTACACGAAGGACACACTCCGCTACTACTACATCCAGACGGGCGG
CCCGAGCATTCTGGAGAAAGATGCGAGGGTGACGTACAAG