Description :
From Genome Similarity Track
Location :
Scaffold_264:8284- 24036
Transcript NameFunction/comments
Phyke_g7483hypothetical protein PHYSODRAFT_309120
Phyke_g7484hypothetical protein PHYSODRAFT_343759
Phyke_g7485hypothetical protein PHYSODRAFT_551943
Phyke_g7486hypothetical protein PHYSODRAFT_343761
Phyke_g7487ferric reductase, putative

Sequence
15752 bases(100 bases per row)
GCTCTGCATTGGTGTCGCCATTATCTCGGCGACGCTTCGCTTCTGCGCCAACACgcttgaacttcttgctCTCCGTTTTGTTCTGACCTCGATACTTCTG
TCTATCCCATCGAGACATCTGCAATGAATCACGACACCCGACACCGCCTTCCCAATGCCGAGAAGTCGACTTCTTCGCTGACACATCGTTCCCGCATGAG
CAGAATTTGACTGAGCTTGACTGTTCCTTCGAGCATAAGCCACAGATCATCCGGCTAGCGAACTTGCCCAAATTGGCTTCAGGACAGTCGCTCGAGTCGT
GGCATACGTCGCACGGGAATGCTTTGCCACAGCACTGAAAGCGAAACCATCGCAAAGATCGCTTGTAGTGGTCACACACACCATTATGAGGCAACGGTTG
ACCCAACACAAATATCTCTGAAATTGGCTTTGCCCCTTTCTTGCTTTTTTTGCCGGTattcgcagcagcaccattgGGCGACCCACTCCTTTGatcgcca
gctcctgctATCTGCCTGGCAACAAGGCGCTTTGTCATCATTGCGAGCTTGACGTGACAAGAAAAACATGCCTGTTCTGATCGTTGCCTCGGAGTAATTC
GCTCCAGCAGGGCTTCACACCCACACTCCAGACAAGTGGCTAGCACGTCGCTTGGCAACACGTCAATAACGGAGCAGTTTTCAGTATCAACGTAGGATAG
CACGTTGCTCTGCGAATGGGCAAGCACAGGCCGCATTGTCACGTGGTGAAGAACACTGCACCGAGGGCACCACTTTTGGATCTCTGCAGAGTTCAAACTC
AGAACGGCGTCAAACTGTAATGGACAGTTGTTACACTGGATCTGACAAACCAAGCGATGAGGAACAACCGTTCCGATCTCGTGCAGAAACAGATTTTCCA
GGTGAACTTGAGTCCCTTTCACATCAGGTTCTGTTTCAATGACAACACGCTGCTCCGGTGGAGTGATCTTGAAATTAGAAGTGTGGTCTTCACTTTCAAT
TGGAGGaacttcctcttcagctttCTCTTTCTTGGAGGTGATCATAGTAGCAGGGTCCACTCCGCGCCGTACAAGGTCACACAGCATCTTGAACCGGTCG
ATACATTCGTTCAAAGATCGGCCCTCCACATCGTCCGCAATGCTTGTCCATCGTTCGTGCTTGTCCATTGACGCTGGGTACTTCTGCAATGCCAAATCCA
GCGCGCGCTGCTGTGTTTCTGACCActcgctcttgctgtttTCACATTGCTCTTTTGATGGTGCAATCTCAGCgttttttgctgctgcagaagttATTGC
TGAGTCTGCAACGCTATTCTTTACAGCTTTTGCGGGTTCAGTCGAAGTACTAATCTGGACGACAACCGCGCGTGGAGATACCTCGGATTCAAGCTTCTTG
GCTTTGCTACTTGTCTTTTGCTCGTGAGAAAATTTGCATTTATCCCCGTCACGACACTTGTTCTGAGCGAAGAACTTGCATTTGCGGACACGAGTTTTCT
TTTTGGGCTTAGACCCCGCTGCTGGCTCTAGTGTCGAGTCCTTCTCCGGAAGGTTAGCAGGGTCAGCCTCCCTGATAACCGTGGTTCTAGCTGCATCCTC
AGCGTCCGATCCACCTTCAGCCATCTTGTTGGTTTTCTTTTCATGTAAAAACTTGCACTCTTCACCGTCACGGCAACTGCCTCTAGCAAAGAAGCGGCAG
AGTCGTTGACCTCGCCTTCTCTTGGGTTTCACCTCTTCATCCGCAGTTGGTACCGCAGGTTCCTCTTGCTGTACTAGTACTGTACTGCtctccgcttctt
cttcctcgtcatcaacGTCCTGTTCGAATGGTAGAATAATCTGCCAGAAATGATTGTCGATCCAGGTCAGTAGCTTCCGTAGAGAAAAACTGCCGCATAG
TTGCTGTGCTCGGGCGTTTACAGCAGCGTTCAATGCAGCCACCTGTTGGTCTGAAAGGCGACTACTCCATTGGTCAAAGTCCATTTGTGGAGCCTCCTCT
GGGTACGTCCCTGGCAGTGTCATTTGCAGCTCCACTTCGCCCTTGAGCCTCGTTGGCAGTTCTGGGTCCGACAGACTCAAGAACAAGCGCACGAGCTTGT
TCTGCGTAGCATCGTGCTCGTTCACCAATTTCAGATGATAGCGGCGCTCTAGTGCCATCCACTCCTTCTTGGCTGAGTCTGTCTCGCTCGCGAGCGCCTG
CTGCCAACTTGACTCGGCCATGGTGTTCGTCCTTCAGTGCCGATTCCAGAATGTGGCTTCGAAAGTGAGCCAATAAGCTGTAGGATGAAACCTACAAAGA
ATATCTTGTAGATTTCGAGTGGAACCTTGACCCAAACAGCTCGTTCCTAGAAATTTCCTTTTGGTACCATTATGGGTATTTTACCGTTTTTAGGTCAAAT
AAAATTCTGTTAAAAAAAACGAGGTCATGTGGAATGTTCGTCTGCGTGGGCCGCAAGGCaagcaggtggtgctgcaggtggaccCGGACGCCACTTTCAA
GAGCTTCTCTGGTTCGTAGTATTCGTTGTCTAAATGTAAGACTTTTTTTCTGACGTCTTTGTGCCTTTTACCTgcgaagaacttgctgcaaaGGAAATGG
GTCTCAAAGCCAAGTATGTTCCTGTCTGTAAGTCTTTATACTGCTGTACATGCGTGCGTTATCTGACTGGAATACTATCAACTAACACAGCGTTAATACA
TTTCAACAGTCCGGAAGGGTTTTCCGCCGCGTGCAGTAGAAGTAAATGACTCAACACTCGTCAAGAGCGTCTTGGAGGCAAACGAcactgtggtggtgga
cgcagcagcttcctccagtGGTGCAGTCCAAGCAAAGGTAAGTTCGTCAACTGCAAAGGCAAAGGGAAAGCGAGCACCTACAAAgaaagcaacagcagcg
aaaACACCGAAGGGCGGTGTACACACTCTGCACCCTCCAAGCGGtgcgaagaaggcagcagcaccatccaAACGTAGAATAACAGGCAGTGGACATCAAC
TTGGGAGTTCAGTGGATGCTGAACCTTCGGACACagcggaagctgcaggagatgatCAACAACCACAGCATAAGTATCGTCGAACTACTGCGATCAATCT
AACGTCgaaggaggacgtggagatcaATCTGGTGAATGCCGTTAGTGGGCAATCTCACAGTCGTGCAGCCAAATTTTTCCGCGCAGCGACAAAAAGCGCA
GTCGATCATCAGTATGAGTTAACATTGGCCAACGCTCGCCTGAAAGCAGCAATGTCTAACAGTTTCGAGACTGAAGAAACGTCCACGACTCGGCGTGCTG
ATGGTAGCTGGGCACAAATGCACGTGCGGTTTAAGGAAACACCGCGTAAGTGGAAGGAAGAGACAGTGGATCTGCTGAAGGAGAATGAATTGCAGGCCAT
CTTGAAATACGTTTTGTTGTCGGGTGGTGAGACTGGCCGTGAAATGCTGAAGCCATTCAACATGGCGCAATTGTCCACTCGAGTGTTTTGGAGCATCGCG
CGTCTGTATGATGGGGATGTGGCTGCCGGAATTGCAGATCTGGTGCCTGACGAAGACTGGTCATTTTTGGATATTCGTACAAGGTAAACTTCACGAGTTG
TTTTATTCtgctgagaaggagagaTTGAAGATTAATTATGACGGTTCgttttgcgcttctttttCATAGAGCTATGTCAAAGAAGGCTGTGGAAGCGAAG
GTACGGCAGGCAATGTGTGGACGGAATATTTTGCATTATAGATACCTCAAAGAGTGCCGGTCTGTTTCCTTCGCTTTCATCACTGACAGGCAAACGAAGA
AGAGTATAAACTGTGGAAGCAGGGTCGGTCTCAATGCGGCCGCAAATCGCCCCCAGAGCAATCAAACCCGGTAgcaggaagaaaaactgaagcaaaaaGC
CACGCTGCTACTGACAAAGCGATGAAGCCGGACGCAATTTCGGTGGACTcaagtgatgaagaagaggttAAGCAAGAGGCTGCAGAGTCGAAACGCAAAC
AGCGAGTCCACGCACCAGCTTTATCGGCTGAGGATGCGACATCGACTACTCTGcgcaatgctgcagcgcaagcTGCACTCTCACGATTTGATCGAAGTAC
ACAATCAAGTGCTGTTTTATCTGCGTTTATGCAAGAAATGAAATCCCCAGTACACCCCCCGACAAGAGCAGTTACAGGGACCCCCGCTCCATGCAACCCT
AATGACGAGAAGACGGATTCTGAtgaagaggtggaggaaACCACAACGGTATATTGTGATTCCTGTATGAAGGCACGTATCCTCTCTTctgaagaagcag
ccaaAGCTTGTCTCGACAATGATCCATGGATCTGCGCTTTCTTAGTGAAGACTGGTCGCACCGGTGGGTGCGACGCTCTTGATGACGAATTGGTGCAGAT
CGCGGGtgctccaattgctgaaTGGCTGCAAAAGGCAGGTATGACCACACGAAAGGAGCTAGCCGACGCATCTTCAGGCTCTGCGATGCATGCACTCGTG
AACCCACTGGATTCGTGTGCACAGACGTTGCAGGACACAATCGAGAAACTTATCAATGAGGTGAGTGGTCAAACGGAGGTTGGATTATTGAGCATGTGTT
GACCCTTTGTGAATGAACCAGGCACGGCTTGACGAGGTAAACGACTGGATGGTGGAAATCGTTGGCGACGCTGATCTCGTTGGACgcctggagctgcaaa
agtTGGGTACTCCTGCTGACCTGCTGACTACACCAAACGACTTGATCCTTCAGgccgtcagcagcaccgtcgaAATATCTATCCAAGTGGTCGAGTCCTG
GCAAAAGCATGCCGCGCGTCTGGTGGATCAGCACCCTTGGTTGGTAGAATGGCGCACTCTGTAAAAGAATAAACACACAACTCAGAGCATCTTCGGAGTA
GGCAATGCAACGTTCTGCTGCTTTATGCAAAGCTATTGAAACCGAAAGTCTTTTTCTTGAGTTTTTCGTTTTCTGTTTTCTGTCTTCTACACGCAGCGGG
AGGCGACGATAAGCACGGCTCAGGTGCGACGGAATGGTAAGGCTCCCACTCGTTCACTCCTCATGATCGCCTCCCACACACAACTAGTGTTGGTCTTGTC
TCCGTCCTTACCGTTTTGCAGACCATCGCCCGCTTTCTTCATCGTATCTTGCTGTCTTGGTGGCTAGAACCATGAACTGCTAACTTGCTGACTACTTAGT
CAATCTTAATGGAGCTGTAGATCTTACGCGTAAACCAGAGGCAAGCGAAGTAGCCGATGGTTCccgtgaggaagaagaacgtgaCGGAAATCAGGAACAT
GTAACCGAAGTACAGAATTCCCGAGACGAACGCCGTAATGTTCaacttcgtgaagaagtacaGGAACGAGTACAGGAACAGATACACGGCTGCTGAGCCC
GACGTGAGGAAcgagcgccaccaccaacggTAATCCTCGGCACACAGCTGGAAGTAACACATCACAACCGTCACCTCAGCGCACGTGGCCACCAAGATCA
GTAGCACGATGAACAGGAATCCGAACACGTAGTAAATCTGGTGCAACCACAGCGCAGacatgatgaagaacagcTCGATAAACACAGCGCCGAAGGGCAG
GATACCTCCCACCAGGATGCTGAAAGGTGAAGTCAGGTACCACACTTGCTCCGGGATCTGGCGCGCAATCTGGTTCGTCCGAACAGGCTGCTCAATCGCA
GCGGCCTTGAAGCCAAAGTAGCTGCCCAAAAACACGAGCGGCACCGAGATACCAAACCACAGCACAAGGAGCGCGAAAAGCGTGCCGAACGGCACAGCCT
GCGACGAAGCCTTGCCCCACAGCACCAGGTTCAACAGGAAGAACACGGCAAAGAGCAAACCCGGGTACAGCACAGCCGTCAGAATagtgttcttcttcca
gtccTTACCGTTGAACATCTTGTAGGTGCGCGAAGAGTAGTAACCAGCAAAGCTGCCCATGAacacgaacagcagcaacagcgtcgtAAGAAGCGAACCA
CGGTTGGCCGGAGACAGCAGGCCCAGCAGCGCAATGACCATGGTAGATGCACTCATGCAGACCACCTGTACACCCGTGCCTACAACCACTGAGAAAAGCA
TAGGCGAGAGCTGAGGCGGACGGAACACATCACCGTGGACAAGCTTCCATCCCGACTCCTCCTGAGCCTCCTCCGTGGTCTGCACCTCATTGTAACGAGC
GATATCACGGTGCAGAGTACGCAGCATAATCATAGCGATCATTCCCGTAAGGAACAGCACAATCATGAGCGAGTTAATGATGGAGAACCAATGAATCTGG
TCGTTcgagctcttgctgctgataaTCCGGTCCCAACGCTCCTCCCAGACGATGTCCGACTTGACATACTGCACGTCGTACGTGTACAGCACTGTGGTCT
CTCCTTCCGGATTCAAGTACTGGTAGTTGCCCTGCGATACCTCCTCAATGTTAACAAACTTGCCACAAGTATCCGACTCCAGTTCCTTGCCAGCAACAGG
TTCATTCTCGTAGCTGTGCTTAATGGAGGTGGGGACGACTTCAAAGCCAACCACACGCCACTTGGGGATGTCGCCATCCTCTTCTGCGTACGGGTCCGAG
TTGACTGAGATGATGATACGGACGTGGTTGTACAGTAAGTACTTGCCATCCTCATCCACTTCGCCCACAGGGAAGCCACGCTTGAACGATCCTGCCTGTT
GAGAGTCTGTCGGGTCGCGATACAGCACCGGGAGGTTGTCCACCACCCACTGCACATAGTACTCGTCCTTGATCATGTCGATGAAGGACTGCGACTGCTC
GGAAGTGTACGTCATGGGCTTGCACAGTACTTGACAGATAgcgtccttctccatctgcagatTGTAGAGCGAGTCCATGATGGCGTCACCAGCCATGATC
TCGCCCAGgttctcctgctgctcgttggTGGCCGTGGGTTTGCAGAACGGTAGATAATAGTACTCGTACGGCACCAAAGTCTTGGTCGAAGTGATCTTGT
TGACGTTAAGACGCACAGTGTCTCCGGCGGACCAAGACTCGGGGGCAACGCCAGGCACGTAGAAGGCTGCGCTGGCCTGTTGTACGGCCAGGAGCGCAGT
CAGCGCAGTCGCTGCCAcgctcttcatccacattTGTGTCTATTAACGATGTCGGGGGGGAAGGAGGGGAACTCGAACTGCCCAATGAAGCTACTTGAGC
GTCTGGCTTCCTCGCGGTTTCGTGGGCAAGTGAGGGAGAGCTGAGCACAAGCTGTATCAGTGTCTATCAAGCACAAAATGCAGCCAATCGGAATAGAGAG
ATTTCAATTTAGACAAATCACGTGCCGCGACGTGTGGAGTCGTGAATGGTCATAAACTAAGTTAGGATTTCCTAGCATAGGGTTTTGTCTGATATTTAAG
GTGGAGAACACTATTCTTCTGTAATTACTGATTGCTTCTTTTCCTGAGCTCTTCAAAGAGCAACGCAACATTCCAGCAGGGAAAGCTCTCGCATAAGGTG
ACGCCTCGCTACCTATCTATCTATCTACTGTCATTCTTGCGGGGGTAGCTAACAGACGACATTAAGTGGGGATCCAATCAAGGTGCGTGTATACCCATTA
ACGGGATCGGTTCTTACCTGACCCGACCCGATTCCCTTCAACATGACGCTACAATTAGCCTTTGAGCGTCTTTCAACTGAGATCGACTGACTGACAGATC
TCTGGTCTATTGTTGTCGTAGGCTCAGACCTCACACTCGATAGTTGGCAGCCAACGCAAGACACTGAACTGAGAACAAGACAAGTATGGAGGTGGCTGTC
GTCTCGGAAGAGGTGGTCTCAGAGGCGTTGCACCAGCTCTACAGTCCGCTGAGCTCGCCACGTGTGCGGCGACGTGCTGACTCGCTcctgcagcgcttcc
agcGCTCCCCTGAAGCTACACCGACGGCATTGAGCGTTCTCCAGGCGCCTATTGTAGACACGGGCAGCAGTGACCACAATGCGCTACTGCGAGCCAAACG
AGCGTTCGCAGCGTCAACGATCTACTTTACAGTGGCCTCTTACGTCCGCAAATACAAAATGGATGACCCTGCCAAGTGGACGCCCGAAGAGCGGCTGCAG
CATGAATTACTGGTGAAGAATTTCGGACTGATGGCACAAGATGTGTGGAATGTTTTGACAGGCCCCAATGGCACTCAGGAGGAACTCAACGTGCAGACTC
ACCTGGCTCTTACGATCGCAATTATTCTACTACGCTTTCATGAGTCACAGGGTGAGACGACTGTGGTTGGAGCTGTAGAATGGCTTGTGCAGAACCAACA
GCATCCAGTCAGTGATTCTGTGACAGCTACTTTGACCAACTTTACGGTGCTCCTTACGCTGAAGGTTATTCCTGAGGAAGTGGCCAATAAACGTGTCAAA
TTTACGAAGACTAAGCGTGAACAATGCGAGGACATGGTGAAGACGTGCGCCGCACATGTTATCCGGACTGTTCTACCGTCCATTACCGCTGCAATCGATG
CTAGTGAGGAGCAGGCGCAGTTGCGTGGTCTGTTACTGCAAACATTTGCGAGCTGGGTAGAGCATGGAACAGTACCGCCACCAGCTATTGTGGAGTGCGG
ATTGCTGGACCGTGCTTTTCATGAAACGCTAGTGCCAACATCATCGGTATATGCGCTGCAGGTTGTGCGTGAAGTGGTACGGGCCTGTCAGCACGATGAT
CATGTGCAGTTAATGGAACTCGTGATGAACAACTTTGTGGTGCTCGGGAAACATCTTCAAGAACGTACAGCTGAATCAGAAAGTAGTATGAACTTCTGTC
TTGCTGATTGCGCGACAGCAATTGCTGAATGTGGCAAAGCGTTTATCGTGTATTTTGTGGACTACACACTAGAGATGCAACCGGGGTCATTGGTATACGA
ATTCCTTGACACCATTTTATTCTTCACGGCGTTGAACAACCTGGACATCTCGAACGAAACCATGGAGTTCTGGATCGAATTCCGCGTGTACATTTCAGGG
AAACACGAGCAACGCATGTACATATTTGAGACGTTCATATCTCGGTTGCTTCTAATTCTGGTGGAACGCACGGAATATCCTGAAGGTTTTGAATTTTTTC
CCGTTGCTGCAAAGgagcgcttcttctcgtaTCGAAGCGAAGTTCGAAACGTATTCCGCGCACTAGCCACAGTCACAATTGCCAGTGAGGACAAATTCAT
TGTAGATGCAATCCATGCGATCTTCCAACAGTACGAAGTTGCCGACTCCGGCACCCTTGTGCCACCAAATGTACGTGAAGATTCCCTATTTGACACTCAT
TGTATAATACTAAATCTATAACGACGTGTGTGCATGTacagtggtggcgacgtACGGAAGTCTATGTTCATGCACTAAGTGCACTATCAAAATCTATTCG
CGAGGAAGATACATATCTTGTTCCTAGGCTTTTCGAGTGTTTGTCGCGGAAGGAGCCTTCACATAGTGCACTATCTCGCACAGTTACCATTTTTCTTGGT
GTGGCCGGGCACTGGTTTGCGCGGCACCCAGAATTCTTGATGACCTACGCATTCCAGATCGTGTCAAACGGGTTCGAACTCTCTCAAGACGATACTGGTT
TCCCATTTACCCAACACGGACAGGAAGATCACGTAGGTGCTGTGGCACTCCGTAAGTTGACGCTTCGATGCGGCACTTACTTTTTCAACCCGCAGTGGAT
GGATGCGCTGGTGAACCTGTACCGCTTAAACCGTGCGACGGCAGGCGGACAATCGGTGTGCTTGACGGGAAACAGTACGAGTCTTATCGTGGACTCGATA
TGCAATGTCCTTTCAAACGTATCGTACAAGGATACGCTTCCTGTGGTGGAGGAACTTGGTGTCATCATGTTTACAGACCTTGCCTCGCGGTACAATCAAC
TGAGTGCGGAGGACGAGAGCTCCGTGGATTTTCTAAGCGAAATGTTCACTCACCTCCTCGTGTTGGCTACTAAAATCCCGCTGCAAATGAGCCAGGAGAC
CCCTCATCctgtgctgtgcttgctgcaaaagcagtGGGGAGTGCTGGAGACAATATTAGGCGTATATGGCTGCTGTGAGGTCGTGGCGGAGCAATTCTGT
TCGCTTTTGGTGGGAGTATTCGAATCACTGCGGTCTCAAGCATTAGAACTCGCGTCTGCAATCATGCCAGCGTTACTGGAACAATTTTCCCGTAGCTATG
ACGGCAATTATTTACGAGTGATCAAAAGTATCATTAGTTgtgctggagacgatgagGCTACGGCCGCAAGCTTGACGCGCGTAACAGTGATTGTCTGCGA
GGGCTCAATGAGCAAAATTGCGGCAGATGGCAGTGTCGATGAGAACCCAGGCCTTACTGTCGCACTATTTTCTCTGGTAGCAGAGTGCGGTACTCACCAC
CCGTCCATCTTAGTACAGTCGAACCAGCTGGAGCCTGTGCTAGCGTTATCACTACACGCTTTCAAGTCACAAAATCCCGaggttggtgctgcaacacTTG
ACTTCTTGCTTGAAATGGGCTCGCTTTATGGTCAGATCCTTCGGATCCCGACGAGCTTGCTCCAGGGCTCCGAATTTGCGGGCAAActgctcctccacca
gcaaatcCAAACGCTGTTCTTCGAGAAGGACGTGCAATATCATTTACTCTTCGCGCTGTTTAATGCTGCGGCAGGAGGGATGCCGCCAAATTTGCAGGAG
AAGGTTGCAGAGGTTGTTCGGTCGTGCTGGGTGTACTTCGGACGACAGCGTAGTGAAGAGTTGGTTCACCGACTTCTATCCGACAGCACCTTTTTGGGCT
CACAGGTTAGTGAGCGAGCGCGGGGTGAATTCTTGAACTTTATTTCTACGCCGACGAGTGTAGAGAACTCGCGCAAATTTAAGCGAGTGCTGACCGCGTT
TTGCGACCACTTCAAGCGGAGTCTAATTGATAGTTCGAACGGAGACTTGATCGGCTCGTAAGCAGGGACCTGCAAACATGAGGCTTTTACCAACGATACA
GACTGAGAGGGGCAACACAGTAAGGCAGATATCTAACGGGTGCGATGCATGTGGGAAAATCGTCTCGATTCCTCTTTGGGCCTCCGCTTTTAGCAGTGCT
CGCTTTTACTGAAACGGGTTACCAACATCCTCCCAAGATGTCGCGTTATTCGCCGTAATGGCCGTGATCAAGTGTCCACTCGGCGGGCGCGCTGCAGTGG
GGGCTTCCGACCACTCCAGAATCTTTTCCGCGATATCCTCCGCCTACAATTCCCATGACCAGATACTTAGAAGACTGCAAGAATACCAAGTAAGTAAACT
TGCCTAATAAAGTTGTTTCTTACCTTAGTCCAGCTAGAGAAGTCTGCGTCAGCCATGAACTTTCGGTTCATCGGGGTATCGATCGTAGACGGAAGGATCG
CCAGCACCGTCGAGTCTTCAGGGAATTCACTCCTGTGCGTAGATAAAAGATAAATAGCAAAATGATTAGGCTCAAGCTTCGAGTACGGAAAGGCCCAGTG
ATCAATCGCAGTCGTACACAGCACTGGCTACCAAGTGATGAGTAGCTGCCTTGGTAACTCCATACGACACCATGCCAGGGGTGGCTTGgagtgctgcagt
tgcgcCAGTCAGAACCAACAGGCCGCCCGGTGCCAGCAAGTGACTCGCCAAATACGTTGCTACAGCCAGATCAACCCACATACAGAGCGTCAAACCACAG
ACATCCACATCATCACACACAAAAATTTCAGACTCTCTCCTCACCCAGGAAAGCTGACTCAGTATTCTTCGCGTGCATCTCCCCCAGGTTCACGAGCGAG
TCCAGATCGCGGATACTGCCACCCGCCCATCCGCCAGCAGTGCACACGACGGTGTTCATCTTGCCGTATCTAGTCATGCAAGTTAGCAACCTGTCATCAT
ATCTCCTTAATTAGTCGTATAACCTGCTGGAGATGTCCTTCAGTATTTGATCCGCCTGTTTAAGGGAGTTACGCCCCGTCAAAAGCACGTtgtcgtcggc
gtcttcatTCGCTCTGTTGCAAAACCAAAACTCCGTCAATTCAGCATACAACTAGACAGCGTTAGAAGATGTTAACACACGTACGTGAAGCCAACTGAAG
TGACGCCCCATGATGAACGCGCAAAGTGAGATACTACGCCACGGCCCAGTGCACCAGCGCCGCCTACCACGAGCAACTTGTTCGCCATGGAGCTCTTTTA
ACAATGCCAGCTTGCATGTTGAGGAGTTCGCTAAACTACCTCCCTCTAAAGTGACATAGACGTTAAAAAACTTCCTCTATAATAGCAGTTGATCTGCTGT
GGACATGTTCAACGCGTCTCAACACAGCAATGAGACTACTATGCCAAACGATGACGTCCAAGGTTTGGACTCCAAGCAGCCCAAGACCCCGCAGGCTTAC
AGACGCATCGTGTTGAGCGCGCTGATGAAAAGCCAATTTACTAGTCATGCAGTGCAAGGTAACACACGGCAGTTCAGGTGTCCCAGTCAACAGCAAAGAG
GGATGAGGTACGCACTTTATGATATagacttcaacttggacaaTCAAAGACACTTGACTAACTACGAACTGCTTTCTACTCTGCAGCAAATCTACTGACG
GCGTTATGCCTTGTCAGTACATTCTTTCTATGAGAACTTCTCTGAGTGGAAGTCGAAAATCGTTCCATCAGAGGACGAATATTTTTTGCACGTTTTGTCC
AGGATCTCCTCCAGTGCGTGGGGTCCACAGTAGAACACGCCAACCTCTTCACCTGGGTGTTCGGCCTTGGCCTCTGAAAAGATCTTGTCCCAGTCCGGAC
GACCGAAGTGCGTGAGCTGCTTCGTGTTGAGACCAGATACGAAATCCTTGCCCGTCTGTTCGTGCACGAACTCCTGAAACATCTTGAGCTGCGACGTGTT
CTCGCTGCCCTTCAATGAACTTAAGTACTGGTGGGTTTCGATCACGTTGTCGCGGTCCATTTCAGCGATTTGGTTCATCGTTTCTTCGAACCAGCTCAAG
GATTCCTGTCCTCGAGTCACCCAGTGGAAGTAcagcttctggatcttgAACGAACTCGGGTGACGGACGTGGTTGCAGTTGAGGCAGCGGTTGTCCTCCC
ACAGGTGGACGACATCCTTCAGAATGGAGGCAAACGGTGTGACTCCAATGCCACCGCCAACGCAGATGACAGTCTTGTAGCGGTGGTAATCTTGTGTCGG
AGCTCCAACCGGACCGTCGAGATATACATCAGGGTAGAGCACCTTGCGCTCATGGCAGTCCGCAATAACTCGGGCCATCGCTTTTGTCCAGTCGCCGCAA
GCGCGCATGTGAATGCTGATATAGTTGTCTCCAGGAGCGGACGAGATCGTAAACGGGTGCCACTCGTGGGAAGAGAGCAACGGACAGTTGATAAACAGGT
ACATGCCCGGGCGATATTCGAAGCGACGAGGCTTCTCCATGAACAATGCAATGGTGCCGTCCAGCTCCATAGCCTCCATGATGCGGACCGGTGCAGCAAA
CATTTTGGCATACCGGAAACGACGCTCAATGAGGTAAATGAGGAATGGAGGTGTGATCCAGATGTAGGACGAGGAGCGAGCAAGCCACGAACATGCACCG
TGGAACGACAGCACGATGAGGAACGGGCCGAATAGCATATGCGAGTACCAGAAGAGGTTGAACTTGCCCTGACGGAACTTGGGAATCGCAGCTAACGGGA
ACGAGATGCAGGTGATCGTCAAAAGAATGACACCGGTCCAAACTGGTAGAGATTGCAACATGGTCATGAATGGTGGGCGCTCGTCGTTTACGAATGATGA
CACATGGCGGGTAACGAAAATGGAGCGCTTGACCTCTTCTGGAGTAGCAACCAGGTACAAGTAGTATTCGTTGGCAATGTGAGCAAGTGTGTGGATGATA
CCAGCGCTGAGTAGCACACTGCCCGAAATCTTGTGGAACGCGATGTGATCGTCGAATGGAATGTAGCGCCACAAGAACCGActgcgcttcatcacctGGG
TGATAGAGCGGCACattggcaacagcacaaagACACAGTTGAGCATGGCGACCTGAGCGTTGGCACGGGCGATTCGCAGACCCCAACCGATCGCGGGGTC
GACCTCGTACATGAACCACTTGGCCCAGAAGGCAATATTGTTCACGATAAAGTATGCCAAAAGCCACCAGATACGCAGCTTGTTTGAACTGTAAAACGCG
CCCACCTTGCTCTTTGGACGAATAGGTGATGTATACATGGGGGCCGATTTCCGGAGGTTATACGAGTCGTTGATGTAGGGGCCGAACACGACCACGAACT
GGGCGTATGACATCTCGTCGTTTTCCACTTGAGCCTTGCGGAACATGAGATTAGCCACGGTCTTAAAGTCCGtaccaacaacatcaaggTGAGCTGCCGA
GAAATTTGactccagaagctgcacgaTCTGGTCTTCAATCACGTAGCCTGAATTGTCTGGGTCCAGTGTCTCGAAAATAAAGCGCAATTTCTCTTCAGCG
CCCACTTCTAGGTCCATGACGGCGTCCACCAGGATAGCGGTACCGTTGATCGTTCCATTGTCGGTGGCATATCCATCGAACTCGTCGCCGTTCACTTCAA
ATGCCTGCGAGAAGGTCTCGCGCTCAATATGGCCACTCTTGTCGGTGATGTTAGTCATCACGTCACGGAGCGCATGAAGCTTTTCCATCGGCGTAAAGCC
TGAGTTAGCGTTTTCGTCCATACTCATGGCGACATTATACTTCTGCTCGAAATTACAGTCCCCCAATACAGGGACAGACATGACATCAGAGCCCGGTTGT
GGGCCATACCTTGATCCAGCAAACGACGACAGGTTTGAAGCGCGTGCCAAGCTTTGGCGGACCATTGAAGCGCCCAACATAGCGGTGACATTAGGTCGGC
GACGGGGTCCTCGGTTTCTGCAGTTCGCGCTCATCTGAGGCTGGTTCCGGCCGACGAAGTGTGATGAGGTCGAGTTCATATTGAGAAACTGGTTGCTGTC
CATGAAGTTGGCTGTCTTGTTAAACGAGGACACGTTAGTGTCAATGAAATTGGCTGTCCTGTTGAACGAAGACACGCCATGGTTCATGTTGATCACAGAC
GCGTTCGGCGGTGGGGGCGGGGCCCCTGCGCGCTTGCCGCTCCCTCTTCTACCAGTTTTCCCGCTTTTTTTCCCGTTTCTCTTTTGTCGGGAGTTGGGCG
AAGGCGTGGAGATGTCGACGAATGGCTGGTGCTGACCAGGGGTgatcttgagctcctccGCCTGCGGCCTAGCACCGGCATTTTCCCTCGGGTAGCGGTT
CTGGCGGTCGCGATTCATGGACGCGCCTCTTGTCTTTGTGATGGTGGAGGAGAATCCACTTGTGACTTGCGGTCGCGATGATGCGAAGATGTAAAAGAAG
TTCGCCCGTCGACTGCCCCAGGACTCCTAGCAGGAGATCAATCGGTCCTCCTAGAAACGCGCGATCAAGTGTGGACTCAGACGCTTGCTCAAGAAACAGG
CAGGTGGCACTGCCAATGGAGTTGCAACGGTAAATGGCGAAGTGGAGCGCCAAGCTAGCTGGGGCAGGATCAAGCCGAGGCACGGCTCCACCTGGTCGAT
ATTTGCGGCTTTCTAGCATTGCTGACATGTTAGTACAGTGGAGTCACACCGAACCGATTGacttggattttgtatgGGTGGTCTGTCTTTTTCGTCGATC
GCACCCGCTTTGTTGAGGAATAGGGGATATCCATTTCGGATCTGCCATCTGT