Description :
From Genome Similarity Track
Location :
contig_118:82811- 84624
Sequence
1813 bases(100 bases per row)
GCCGGTGCTCCGTGTCCTCCATTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGATAAT
CCAGTTGTCGTGAAATGCATGTTTTGCCATTGATATGAGTATTCTGATATTAATGTTAGATCAATACATTTAGTAAAGTTAAATATGCGAGAAAGACGAT
CAATCAGTACCTATGCTCGCCTTTCCAGCTTTTAGAAAGCTTAATCTCGGAGAGGCGGAATCAGGGCGTCCATGCTACAACTGGAAGTGTTGATAAAGTG
TGCTGGGGCCTCACAGAGCGAGTTTTGACAGGATTTTGCGAGTTTTCGGTCAGTGTGGAGGTCACTTCTGGACGCCGGCAGAGAGCGCTTGCTTGCTCAC
TGGCGCAAGATAGTATAGCAGGAATACCGAAGTGGATGGCGTGCGGGAGTGTACCTCAGGTGGGCGCGAGCACGACATTTCCGCCTGGAAGCGGATTTTG
CTGCTTTTTGTGACGGCTTTGACTGCGAAAGTGTACTTGTACGAGTACTACATGGCCAAAAGCAGGTGAAACATGGTTGCGTACATAGGGGTACGTGGCG
ATAAAGTCGGGGCGTCCATGCTACAACTGGAAGTGTTGATAAAGTGTGCTGGGGCCTCACAGAGCGAGTTTTGACAGGATTTTGCGAGTTTCGGTCAGTG
GGTGAGGTCACTTCTGGACGCCGGCAGAGAGCGCTTGCTTGCTCACTGGCGCAAGATAGTATAGCAGGAATACCGAAGTGGATGGCGTGCGGGGTGTACC
TCAGGTGGCGCGAGCACGAACATTTCCGCCTGGAAGCGGATTTTGCTGCTTTTTGTGACGGCTTTGACTGCGAAAGTGTACTTGTACGAGTACTACATGG
CCAAAAGCAGGTGAAACATGGTTGCGTACATAGGGGTACGTGGCGATAAAGTCGGGGCGTCCATGCTACAACTGGAAGTGTTGATAAAGTGTGCTGGGGC
CTCACAGAGCGAGTTTTGACAGATTTGCGAGTTTTCGGTCAGTGTGGAGGTCACTTCTGGACGCCGCAGCAGAGAGCGCTTGCTTGCTCACTGGCGCAAG
ATAGTATAGCAGGAATACCGAAGTGATGGCGTGCGGGAGTGTACCTCAGGTGGGCGCGAGCACGACATTTCCGCCTGGAAGCGGATTTTGCTGCTTTTTG
TGACGGCTGTGACTGCGAAAGTGTACTTGTACGAGTACTACATGGCCAAAACAGGTGAAACATGGTTCGTACATAGGGGTACGTGGCGATAAAGTCGGGG
CGTCCATGCTACAACTGGAAGTGTTGATAAAGTGTGCTGGGGCCTCACAGAGCGAGTTTTGACAGGATTTTGCGAGTTTTCGGTCAGTGTGGAGGTCAGT
TCTGGACGCCGGCAGAGAGCGCTTGCTTGCTCACTGGCGCAAGATAGTATAGCAGGAATACCGAAGTGGATGGCGTGCGGGAGTGTACCTCAGGTGGGCG
CGAGCACGACATTTCCGCCTGGAAGCGGATTTTGCTGCTTTTTGTGACGGCTTGACTGCGAAAGTGTACTTGTACGAGTACTACATGGCCAAAACAGGTG
AAACATGGTTGCGTACATAGGGGTACGTGGGATAAAGTCGGGCGTCCATGCTACAACTGGAAGTTTGATAAAGTGTGCTGGGGCCTCACAGAGCGAGTTT
TGACAGGATTTTGCGAGTTTTCGGTCAGTGTGGAGGTCAGTTCTGGACGCCGGCAGAGAGCGCTTGCTTGCTCACTGGCGCAAGATAGTATAGCAGGAAT
ACCGAAGTGGATG