Description :
From Genome Similarity Track
Location :
Scaffold_450:8280- 12673
Transcript NameFunction/comments
Phyta_totarag8410hypothetical protein PHYSODRAFT_515366

Sequence
4393 bases(100 bases per row)
TACGAATACGCCCGACTGCCACCTCCTGTGCCAGGCGGACACTGGTAATCCTGCGGCAGCATGTAGTTCTGCAGCGCGCTGAAGCAATACTGCGCTTGGC
CGATGTTCTTGCGCGCATTCTCACGACGAACACCGTACGTCCGAAGCAAATTCGTGAATACTTCCGCGTCGTCGGCGAGAAGACCGTGAGAGCATACAAG
CAGGTTCGCTTCTTCGAGCGTGATCGACATGGACGTACGGTCCTTGGCCGATTTGCACATCGTCACGCGGCCGCCACCAACGGAACGGGCAATGGATGAC
GACAAACTCAGAATGGCCATGCGCTTGGCCCGCCCTGAAAGCTGTATGCTGGCCTTGAGAGCCATCAGCGACGTCTGGATCCGAGCGAGGTCCTCGGCAT
CGTAGATTGGAGTCGACGCTGCATCTctgagctgcttcttcgagacCCAATCAGCAAAATTGTTGACATACGCTTCCAACTCGACCACGTTCTCAGCGTT
GATCTCCTTCTGTAAAGAGTCTTTGCCGACAGTGTTCGCTACTGTCTGCATTTCATTCATTCCCTGCGAGAAGATCACAGGCACCACTCGAATGGGCTTC
TGGAACAAGAACTTCGCGCGCATCCTCTGCTCTGGAGTCGATAGCGGCAAGTAAATGGCTCCTGAGACTACGTCCTGCCCTGGAACTCGGTGCATGCTAC
GACCAGGAAATTCGCTCGCACGGCGCGTAATGATTGGAAGCTCAATCACGATGCCTGATGGTCCTGAAGTGATGGAGACGCGGAAAGCCGCAGCACGCGG
AGACTTGACAGGTCGCAGCTTGATGTGAACCCGTCCGAGCTCCTTGACGGCTGCCTCCGTGTCACCTAGAATTCCTAACTCGTTGCCGTACGTCGACAAC
AAGCTCTCCACAGAGATCAAGAAACCAACCCTCGTAAGCATTTCGAGGTAGTCGATACCGCAGGCTTTTAGTGGATGAGGGCCAAAATCCCGGTGGTCGT
GCGTATGCACGTAAAGCGTTTGCTGGAAACACGTAACAAGTGCACTCATCGCCTGGCAGAACGCAACCTCGAGTCGACGCTCAACATCCCATTTGAGCTC
GTTGTACTTGCGCTCCAACGCGTCCATAGTCAGATCTGAACTGGCCTGCGCTGCTTTCACCAAGCGCGCATGTAGTTTCTCTAACTCTTCACGCATCTGG
CGCACGCCACCGCTCTTAAACCCGTATACATGCGCCGCAAAGGCACCCACCGTCGTGGTACCGTACATTCGGTGCTTATAAAACGGGGCGCGTCCACTAG
CGTTCGTATCaatcgccatcgacgccttcTTTAATTCCACATCAGACATTGAGCCCTGCGATGACGAGTAGCCCCCACTGCTCGATACTCCAAGCGTCAT
TTCATCACCATCTGAGCCACCTAGCGTTATATCGGCTATACTATCCATTGCATCGGAAGAGTCAGCATTACCGTCCAAGCCGTAAATGCTCTGGAACTCT
TCTTCGGTGATCCCCATCGCTATAATGGTTTCAGCCAGCTTCCGCTGCTCAGAAGGAACTGCAACAGCCTGACCCGAAGCTCCCTTGTTGACAATCGTCT
CCGCAGAATCAAACGAAATCATACGCCGACGTAGCGCTTCAGCAGGTTCAAGAGGTGATTCTTCGGACGGAGAAGGCGAGACGACTTCTTTTTCGTCGTT
GGTATCATCGTCTATGAACTGCACCGAATCGAGATCAGTCTGCTGTCCGCGCATGCTGGATTTTCTCGACAAGTGCAACGGCGATGCCATGATCCCAGCA
AACGAATTCACGAGACGAGCATAGCGTGCTGCGCTAGTTTGGTCACCATATTGTACGTCTTTTTCTGACGTGGGGGCTGCATTGCCCACCGtcatcaact
gctgctgaaggttCAGCGCCAGGAAACGTAGATCAGCGTCTGCTTTCATTGTGCTCGGCTTGAACGTGAGTCCGGCGTGTTGAGTGGCTCCGTAGCGCAG
AATCGAGTCTTCCACCTCCGAGATGTATTGCTCCATAGTCTTGACAAGTTCCAGGCGCCACTTCCTCTTTTTCCGTTCGATGACATCATCTTGGATCTGA
ATGATCATCTCAGAGAGCATCCCGATGCTGGTTGCTGGCCTAACTCGGTTTTCCAGTGTAAAGGAGGAACTCATTCCAGATGCGGCCGACCGAAACGACT
CCGAGTCTTCCCACGACTGTGTCGTGTGGTCCGCGTCATTTTCTTGCACAGCACCAAGCGCTCTTGGAGACGCAGGAATCACCGAGGGCAGCGAGTAACC
ACCAACACTAGGTGTCGAAAGCTGGCTAGACGGAGTTGAAGACGAACTGTCatcgccatcttcaagcGCGATCTCACGTTTGAGCGAATCAAGTTTCACC
AGCAAGTCGGATAGTatcagctgaagcagttgatAAGGTACCTCCCACGTATACACACTTTCGATgagctcttcttcgatcAGCATTTTTCCCTGCGTGC
GTTGGGAGGTGGACGCAAGGTTGATCATCTGTTGAGCTATCTCGGAAAATGCCGAGTCATCGTGAGGCGAGGCATCCTCGGCGTCGGTACCTTTAGCCCC
GATATACATGAATGACCGAGTGATGCGCTCTAGCCCGCCAGTGGACATCCCGGCGTGCAAGTCCTTGACTTCTGCTTCGCAGCGGATGACGATTTCACCC
GAAGATCGTGTCCGAGACAGAGGAGAGTACAATGAGAAAATGGATGCACGTCCGATGGCGGGGGCTGCGTCCGTCATAAACGACGAGAGCGGCACAAGTG
GGTCGCCAACAAGCCACTGGCTATTCAGGTCTTCTAGCGAGTTCGGATTTCGAACCGAGTACACCGAGGCACGGAGTAGGTCCTGCTCGCGCATTTCGAC
GGCCAACATCATGTGAAAACACGGGTCTTCTGAGTGTGAGATTTCGGTTCGGCCAATCTCAGCTAGCACCGCGCCTGTCTCCGCGTTCATCAGATGCAAC
ACCACGAAGGATGATGACCTCACAGACGACTTGGACGGCAGCGTCAAATTGAAGCACTGAAACGACAACCACGCGCAGGGCGTAGGCGACACCAGGTACC
TCGAGTCGTCATCGGAGACAGTCACCTGCTTAACTTGTCTCTCGTAGTCGGACGCAGCGGGTGAGCCAAACACGCTGCTTGCAGAATCCAGCCTCGCAAA
TCTGTCGCCTGCCTGCTGCTCTCTGTTGCGTCCGCCCAAATGCTGgcgcaccaccagctccagttgTCGTCTTGCTCGATCCAACACTCCGTTCCCGAGT
CCCAACGACAGCGGACTCGGCCGTTGACCCACCGTCAAATATCCACCCGGTGGCGAGTTTGGTGGCGCCGCGCCGCCAAACTCTACTCCATTGCCGTGAT
TCTTGGCTGCTACCAGCAGCGGTCGAggcagcacctcctgctccagcagaggTGTCGTCTCGGACGTGAGCCTCCCGTTGTTATAGCTCAAGCTTCGTCT
GGACGGGATCTCGAGCGTGGGCTCCACCTCCCACAtgagcacgaggaagagcgcgcAGGGCACGATCTCCGGGATGGCGTAGCCCACCACGACGCACACA
TCTGCACTGTGGATGTCTCCGCAGCCCTGGTGGGAGAACGGCCGCTGGATGTAAATGAGCGTccgcagcaggaacagcacggAGCAGGCGCCCATGACGA
GCACCGTGAACCGGAGCGCGCGcgtgagcttctgctccacgCGCTGGTCCAAACGGCGTCGGAGTCCGTCGCCCGACGGCCGGAGCACGCGCTCCACGCG
GAGGCGCATCTGCCACGTGGAGTACACGAGCCCCAGCgagctcacgaagctgccggcGGCCACGAAGAGCACGGGCAGCACGCCCGTCCAGAGCGTGGCG
CGGTGCAGGTGCACGTTGGCGTGTTGCATGGCGTCGGCCACCTGcgcctcgtgcagcagcgagagccCCAGGACGGTGGCGTAGAAGAGCCCGTTGGCCA
GCACGAAGGCCACCCAGATGCGTCTGGAGCGCCGCGAGATCTTGGGGTTGGCAATGTCGAGCCACAGTAGCGTCtggaagagcacgagcgagaagaagag
gcaCAGCGCCGCGCGGTTCAGCAGGTTGCGCGCGACGCCCCGGCTCAGGAACGACGCGGCGCGCGTCACGGCGAAGAGCACCATGAGTCGCTGGAAGGTG
CTGCGCTGGAAGGAGACGGAAGCGGCCGGACGCGGAGAAGAATTTGACAGTAGGGAGAGCGCGCGACACgcggccacgagcgccagcgtcagGTACAGCG
CCacgcacagcagctcgagagcGGAGGACGCGCGAGGCAGGAACACGAGGCCGTCGTCCACTTGGGACTCAGCGGCGACAGGAGACACGGACG