Description :
From Genome Similarity Track
Location :
Scaffold_582:828- 6265
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_582-snap-gene-0.8ATP-binding Cassette (ABC) Superfamily
Pytir_DAOMBR486maker-pir_contig_582-snap-gene-0.12Pro-apoptotic serine protease nma111

Sequence
5437 bases(100 bases per row)
CGACTCCACTTCGTCGCTTGTCATCCGATCGGCATCACAGAAATTAATTGGTATCGTGGGTGATCCGAAGTGGAATGCAAATCCTTGTGTGAATACGTTC
CAGTCACTCACGCAAAGTGCATCGCACTTTTGAAGAGGTGAGTGGTAAACGGATTGCTGTGCCAGGCAGACTGCAGCTCATCTGAACAGTAGTTCTTGCC
ACTTCGAAAACCCAGGTGCACTTCACATTCGCAACCTAAAGGTAAAATGTACCGTTCACGTAAAAAGTCACATCCATTACCTTTCAAAAGAGTCCTCAAG
TAAAGTGGAGGCAGTGAGATCTAGAACTCATTCGCACTTACGTCTTCTAAGCTACTTCGAGGGAGTTTTTGCTACCATTGTCCACGCGGCCTCCGCTCTC
TCGAAAAAGTTTTCTGAGAATGACAAGACCACTACAATTACTACAGTGATCAGTCTCTCTCTCATCATACACAGTGGTGAATTCAGTTTGCAAGTAGCCA
ACTTATCCCCATAAGCTCCTCTCGAGTGTGGTGATTGGCGGCTGGTTTTGGTGGTCTCATGTGCAGAATGTTCAGGTCGAGAGGAGATGCTTACAGAATC
GCGAGTGCAAAGAAGTTATAGTTCAGCATCTTAAAGAAGCGACCCGATCTGAGTATTCGTTTGGATCAGGAACTTCGGGAACCCGCGTTGTGCCGTAGTC
ATACGAATCGTGAAGAACTTCAAACTAATCCCGACTAACCCTGCATATCCACTCCGCCGCGCAGGCGTGAAATAGATGGTATGCAGTAGAGTTGAAAGCG
TTTGACATCCGGATCAGCGATGACGCCGAACGACTGAGGCGCTAGTCAACAATATAACTCCTGCTCTCTTGTGACTCGACCGTGCTTGGCGAGACCAAGG
AGAATCCGCTTTCAGAAGCTCATTTCTCAATCAGAGCTCCTGCGCACGTACCCCAACCTCCACCTGTCAACCTCACAAGAAGCTCTCAAGATGCCAGGTA
AAATCTCCACCGTCCTCGCCATCAGTGCCGTGCTCGCAGCCGCACAAATCGCCGCCAGACCAACGTACCCTGCTAGGATCCCGAACGGTGCCAACGTGGT
CGGAGTGGACGCCCTGGGCCACATCGACACCTCGGGTGGCGGTGCTCGTAACGCCTTCGGTACAGCTTTTGCCAGCGCGGATCTCGCGTGGACCAAGGAG
CTCTGCGAAGCCGACTCGGACGGCGACGGCCAGACCAACGGCCAGGAGNNNNNNNNNNNNNNNNNNGTTACGGGGTCCAATAAAAAGGTGCAGTGGAGCA
CGGGGGTGTCCCACCCAGGTGATGCCACCAAGAAGGCGGATGCCTCGCTTTAGGCCAGCGCCGCGTGTAGCACCACCACGACCACTTTGACCACCATGAC
AGCGCCAAGCACCACCACAACCACTTCAACGCCATCCATGACCACCGCCGCCACCGCCACCCCAACGCCTACCACGTCCAGCGCTGTGTCCACTGCTCCG
CTTGCGATGGTTTCTGCTGTCGCAGTCACGGCCATCGGCGCCATTTTTGCTTAAGCCCAGCATTGTGAGAGCTCTTTTTGCATGTTTGTTGTGTAGATTT
GGTAGATTTTAATCAATAGCCATTTGCATTTCCAGTTGCTGTTTGTTCTTGTCGCCTCTGCATCGACGCGACTTTCTCTACACATCACGAAGCTTGTTGC
TCGTTCTCTACCAAATTCGATTGCTTTCCAGCGTCTTCGTCATCCTCCTGGCGGGGTCTTCCTACCCGTCACAGCCGCTCATGACGAGAGCACGGGGTGC
GACACATACTCCCAGTCCCATTCCGCGCGTCGGAGCTCAACTGTCGGCCAGTAGTGGTAGTCGGTCTTCAGTGTGAACACCTTGGGCTTCGTGTTGATCG
CGATGGTCTTCAGCCGCACCGAGTCGCCGTTTCGGAGCTTCTTCACCACGTTCAGGAACTCGTCCAGCGTGGCCGTGCGCTCGCCGTTCACCTCGACGAT
CCAGATCGTGGCGCGGAGTCCGTACTTGTGGGCGGGCGAGCCGTAACACCAGCGCGAGCAGTATACGCCACCACCTTCTTCTGGGATGTACCCAAGCGTC
GCGACTGAGTAGTGTGGCTCCTGCACCACAAGACCAGCCCACACGACGACGCGGTCGGTCCCCATGGCCGACAACTGGTTCGTCTCGACTGTCACGCGCA
GCTCTTCCTGGTTGCGCAGTACGAGGAGGTCCATTTGGGTCTTGTCTTTCACCGCCGACTCGACATCCGCATCACGAACAACCACCTGTCCGTCCACCTC
GAGCAGAAGGTCGCCGCTCTCTAGCTTCTTCGCGCAGTCCGTTCCTGCAGCACTGCGCTTGATCCCGAGGATCTGGCGCTTGTCGTCGTAGCAGCGCTCG
AGTTTCTGGATCCAGTCGTCAGAGAGCCCGAGTCCAGCGCGCGCCTTCGACAGCGAGTACGTGAGCAGCTGAACAGGCAGAATGTTGACCGAAGGTGGGA
TTCGTCCGTTGCCACTGCGAAACTCGTCAATGACGGGGCGAACGACGCTGATCGGGAGACCGCGGAACACTTCTTTCCGTCCTGCCGCGTCCTGGTAGCT
GAACGACAGCCAGAGCGCATTCACGCCACCCTGTTCGTCCATAAACACGCCGCCGACAGACTTCGTCGTGCGATCGAAGTGCAGCACCTCGACATTTGAC
GCCTTGTAGCGCGGCGGCTGGAAATCGCGGAACACCAAGCGGTCGATCTTGGTCACGACGGACTTCATTGTCACGACGGTCCAGTTGCTGCTCAAGCCAA
TATAGTCGGCTGTTTCCCCGACCTCCAGCGGCTTCTCCGAAAGTGTCACGCTCGCGAGGTGGGAAGCCACCGCACCGAGTTGGCTCGGATCGTACTTGAC
AATGGAAAAATTGTGCACCGGGTGCACAAACACCACCTTTGCGGGGACTTCCACGGACGCAGCGATGGTCACAAGCACGTCGCCCAGTGCGATCGGCACC
GTGTTCTGGTCTACAAGCACGAAGCCCTGCTCGGCGTCGATCACCAGTCCCATGCCGTGGTAGCTCGAGCTCGAGATGCCGTCGATCATGTACGGGATGT
CGAACGACACCATCACGAGCGACTGCAAAAGCCGTTTGCCCAGCTCGCTTCCTCCTGGGAAACTTAGCGGCGCCGGCGCGAACGTTGGAATGGACGTCAC
GAGCGAGTTTCTTGGTGATAAGTCTGGACAGAGCTCCGAGTACCAAAGTCCGTCGCGGTCGTTGCGCGTGCACATCTGCATCGGGAACCACAAGCGGTCC
ATCATGATGAACGCTGTGCGCACGCGGTGGCGGTCGCGGATCATGAAATAGCGCAGCACGGTGCGGTACCCGTTCGGCAATGCTGCGAGCACGCGCACAA
ACTTGTCCAGGGTCGGTGTCGGCTTGCCGTCCACCGCTGTGATGATGCACGGCTGCGTCAGGTGCGCCTTCATGAACATGTGTCCTGCTTGTGCCAAGTA
GACCCCACCCACTGGCAGTGACGCATTGCGGGCTTGCTGATACGACAGTGAGTGCACGATGCTGCCGCCAACTTCGAGGTACTGGTGCGGCGTGACCTCG
TGGAGGTCGCCGATTTGCACCTGCACGACCTGCGTCAACGCGCCGCGCTGGACCTCCATCTCGACCGTTTGCCCCACGTGTGAGTCGAGAAAGTCCTCAA
TATTGAGGAACGTCGTCTCATATTTGCCTGCAAACTTGATCAGAATGTCTCCAGTCTGCAGCTTCTGGTCCGCTGGTCCGTCCTGAATCACCTGGTCCAC
GACCAGCATGCCTGTCTCGGCTGGGAAATGCTCACGAACCACCGCCTCTGTCTCTGCAGGCAATCCCAGGCGACGCACCTCGTCGAACGCCGTATGGCGG
AAGATCGTCTGCATCGTCCCGCGAACCACGTCGAGTTCGTCTTGGATCAGCTGCAATGCGCGCACGACGCGGTCGAGCGGCAGGTAGAACGACGAGGCGG
CTTTCTTCGCCCCGCCAGCGTTCAGCGCGATCGCGCAACCGTCAATGTTGAGCACGGGCGAGCCNNNNNNNNNNNNNNNNNNNNNNNTCGCGGCTGCGTA
GTAGAACGTGTTGAAGTCGTTGTACGTATTGGAGCCGTAGGACGGCGCGTCGCGATCCACTTTCGCGAGGATGCCTGGCAGGATCGACAGCTTCTCGCCC
GCGTCATTGCCCACCACGCGGATCTCCACGCCCACTATGCATATAGAAGGAAGCACACGCACCGTTTGTTAATGACACTGTTTGTATCATCATGGCGACA
TGAGTAAAAGTGCAATGACGCCGTTACCTTTCGCGCCTTCGGGCTTGAGTGGGATCTCATGCAGGTCGAGGAACTTGACTTTGCTCGGGTCGAAGCGGAA
AAAGCCAAAGTCGTGCACCGGATCTCTGTTTGCATACACACATGCACACAGATGTACAGGTGTTAGTAGAATCATATAAGAACACAGAGACATTCACTCA
TATATGTCAAGCCAAACGTCATCAACGTACCTGTAGATGGGCACAAGATCCACCTCTTCCTTGTTGAGGAAGATCGCGTCAGCGACCACGGGTCCGGGCG
TCACCACGTGGCGATTCGTGAGGATGATGCCGCGCTGTTGGTCCACCACGAAGCCCGTGGCAACGCTGAAGGACGCGCCGTTGCCGTCGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCGCTGAGCAAGCGGATGCTCACGATGGCGCGGATGCACTTGTCGAGACTCTCCATCCAGCGCTTGGACTCAGCGCCACCGCC
ACTGCTGCTACTGTTGTTAACGCCCGCAATCTCCACTCCGCTGATCTCAAACGCGTCGCTCGGCAATGGCGGCGCTGGCGGCGGACTAGGCTCCTGCTGC
TCCGCGTCCAGCTGCTCGTCGCCGCCAAAGTCCTCGTGCTGGTGGTCGTCCATCGTGCGTGCTTTGCGTAGGGATGTAGAAGGGGTGACACCGTGTGCGG
ATGTAGGTACTGTGGGTCCTGGGTGCTGAGCAACGGCCTCTTCTTGAAGCTGCCACGTCGCTTGGAACTTGCTGGCTGATGCGTCTGCAGAGAGAGCGAA
TGCTGCAGAAATCGCGTTATGATGTGACGGCAAGAGAAAACGTATCCACGGCAGGAATGGCTCTGTGTGTGTTCGATAAAGTGCGAATGAGACACCTTTC
GGAGATAAATGGGAAGTGACTGAGTTTAGAATGTAGAGTAGAAACGCATACCTTTGTATCAGAAAAAGAGCGCCAGAACAGCGCTTACAACATATTCAAG
CTGATAAAACACAAGGAGAGCTCTTTCAACATGGCTACAGTTTTTCGTGGCATGGAACCCCGTCACTAACTCGTATTCTCACTCAGCCGACAATGAAACA
CACACAAATGGATTCATTTTACCTTACTTAGCAGCCC