Description :
From Genome Similarity Track
Location :
Scaffold_133:82799- 88007
Sequence
5208 bases(100 bases per row)
CCACCATACCCGGTGATCATTGGATTATGGAATATTGTGATCGGTTCCGCGATAGGCGGTAGATGTGTCCTCCTGGTCCGCTCGGAGAGTCAGCCTGATC
AGCGTGTCGGAAATGAACATAGACATGTTCTATCACCACTTCTCAAAGCCCAACGGATACATATTCCCTGTCCAACAGGGTTAGATTCGCACTCCGCCGA
AATCTTCTTGGTCATCTCAGCTGATCACGTCCATCAAGATCACATAGTTTTACGATCAGCAACCGTGGGACGTGTACGATCGTATCGTACGACCGATCTC
GTTCAATTCTTCCGGGTGTTTAAAAACTGTTTGACGCGTATCATGGTTTCATGGATTGTCATAGTCAAGCTCTATGGGAAGCATCCCATTTCTTGTGGAT
CTCCCCTGCCCAGCGTAAGTCGGATCCTGATTTGGCTGCCTTTGCGCGAGAAAGAAGGCAGATCCGATCTCGTGCTGGTCCCAGATGGAAAAGTGTGCTG
TAGCTGACCCTGCAGGGTACGATCAACGGTCTTTGCGATCTGTACATCTCGCTGGATCCCATGTTCTTGCCCTTTCCCCACCTGAACGAGGTTAGGGTGT
AGTATCCCGGCCTGTCCGTGCAGCGGGACAACCTACCTAATTTGATCAACGCCCTGTCGATTGATCATGCTGCCGAGCGTTGGACTATCCAGTTTTACTT
TGATCGCCTCCCACCTTGGGTAATGTCTTCCACGCTTGGTTGGTAAGTTGAAGAACCACGGGTAATTTCTTTAGTCTAGTCCCATAACGCGATCTCTCAA
AATAAATTCATCTTATTTCTATTCGATCGCTCCCATAATTCGTTTCTTTCTCTTCTTTTATTATTATTTTTCATCGTGAAGGCACCATTTGGTCTGCTAT
CATCGCTCTCAATTTACATAAATTCCATTCCATCTCCATGTACAATCTCCTTGCACCCATTACTCCTATCCCCGTCCATCAATTTTCCTGCATAGACCCA
TCCAAATAATTTCTCTGATCATCGCTAATCTCTGGCTTCTTCTTTGTGATATTGCATCACCTCAAAACGGTTCCTCCTCACCCGATCACAATAGAACTCC
TGCACCATAGCTCCACAACTGAGATCAGCTTTGTCAATCTAGACTGAGTAGCTGTGCTCCTTCCATTTTATTATATACTGCTTGTGTATTCGGCCATATC
TAGTTTTTGGTCCCAATTGCACATCGATAAACTTATTAACTTCGAATTCGTCTGCGTCAAGATCGCCCTCTCAACTATCTTCCGGCAGCAGCGCTTCGTT
AAAATCGAATCGACTCGCCTCATTAACATTCAGCCTACTCGTAGGGCGTTCTAAGAATACGCGAAATAGCTTCAGATTAAAAGCGTAAATCATTGAGAAT
AGCTGGTACGGCGTACCCACGATTTCCAACCTTTGGACGCGATCGCCGTACTTTCCGGCCACTAGAAAAGGTCCATGCTACATATCGCCTAGCTTCCGAG
CGTATCCTTCCTTGACTCGGTCCAGATATAACCAAACTCGTGACCCGCGATATATATCCAATAAATCTCGATCTTCATTATGTCGATCGGCTTGAACTTT
GATCGCAGCCTCCCATCGGTCATTCACTAATGCCCGTGCACGCTGATATTGGCGCTGTATGCCATATCTCCACCTTCGTGCGTCTTGATTTCAATGTTTA
GTGCTTCATAACGGTAAAGTGGCTTCCATGGTTGATCTTGGATCCCAAACGTAAATCCGGTAAAACGGTGTATCTCCCCGAATTCGATCATGAGCGGTGT
TGGTCGCATAAGTCAATAGCTCTGCGTATTCTTCCCAATCCTTTTGATTTTCATCCATGACATACATTTTGATCGATTGAGTCAGTGTCTGCACCATGCG
TTCGGCCATACTATTTGCTTGCGGTCTATATGCCATAGTGGCTCACTGTTTTTGTCGCGCGATCCGATTAAACGCTCGGAAGAAATCAGACATAAATCCT
GGCTCGCAATCATAACGTATCTCCTCACTCGCACCGAATCGTCTGAACACGCATTCCTTATAATTTTCCCCAATCGTCGGTGCGGATCTAGACGAGCTTG
CTTTCGCGATCACATACCCCGAAAATAGATCAACACACAGTAACAGCTCGGTGTTTTCTGTAAAGGATCGTCGCAACGAAGGGATGGATTTATAGCTATA
ATCTAAACGGGTACGTTGATTGCAAATTACTAGGTGATCCGCTCCGATCACCTGGGAATCCTTTTCCTGTTTCATAATCTAAACACTCTCCTACATACCG
CAGCACACTTCGGTACAACCCACGCCAATGTAAGTTGGCCCTGATCCGTTGATAAGTACGACCAATTCCTCGATGACCACCCTCCAAACTTGTGTAGTAG
TGGTGCAAGACAAATTGCTGTAACTGCTCTGGAACCACCAGTTGGGCCAGTTCAGTAAGACCTCCGATTTGGTGGTCGATCTCGGACAAAAAATAGCAAT
CCACTTTGGTCTGCTTCATAATCTGGTGCGATCAGTGCGCAAAGTTTGACGTCAGTCGCCATTAATCTAGCCACATCTCCAGCCAGTTATATCTTCAGAC
TGGATATCCAATTTCTCTTCGTCTTGTGCTTTCTTAGTGTGATCGATCCGTATCTGCTGCACAACTTCTTCCTGCAAAATCCTCGGCTGAAATCGTCTTC
TTAGTGCTGATCAAGTGATAGCCGCCCCTATGACTGCCTGATCGACTCGTTCTGGTAATAGTAATTCGCATATCCGATTAAGAGTGATCAGATCCTGATG
ATCCTGATCCAAAATCACAATTATTCCTTTCTCATGCCGAAGAGCTTCACACGCCAGCCGATCTGAACTCTGATTGCAGCTCCGCTTCATATTTAGATTT
AATGGTCTGGATATGATCGGAGTTCATCCATTGCTCTATGTCTCAGCAATTGTAGTCCTGGTGCTTTACAGTCGATTTATCCTTGCGTTTGAAAGATCAC
CAAATTCGAATCTCCGCAGATAATCACCCTTCCCCTGACTTGACCGGCAAGCAAATCGAAGCTGAGGAGAAATCCTCGGTATTCTGCTTCATTCACGGTC
AGATCGGGGGTAAACTCGGAAGAAGCACTACGATCGTACATTCCGGTAATTTCCATATAATTGCGCTGTATGCTCCGCCTTTCTATTCACTCTAGCCAAT
CCATCAAATCTGGCTAATAGCAAGTTTTCATTCACTCCTATAGTTAGTGGTGGCATACTTGTCGTCTTTCTTGGCTGCTTCCACGAGGCAATCACAATCA
ATACTTCATCTTCTTCTTTACGGGGAGTTATACTCGCAGCAAGTGTGCCGAGTATTTCATCTTCTTTTCTCTCAGATCTCCAATCTCCAACTTCCAGTTC
TATAAAAAAGCAGCTTATCTTCCCAATCTTCCTTGAGACCTGAAGATTGTAACAACCATGCCAGTGTCGAATATCGTGTAAGCACTGTTATCTCGCGGGA
TACTGGCATAGTATGACAGATATCTAGCATCCAGAGGAGAGCGAACACCTCTTTCTCCACCATCGTGTAATTGACCTCGTTATGCTTTAACGTACGACAA
GAGAAAGTGACAGGCCATTATACACCGTCATATTCTTAAAGCAACGCCGCTGATACAGCCCACTTATTAGCATACACTACGATCACAGGCGATCGATCGG
GGTCGAAATGCTTAATATCGGTGTTGTGGCTATCTTCGCCTTTAGCAACGTAAATGCGATCATTGGTTTCTCCCAACGATTCCTGCCCTCGGAATCGCGA
TCGTCTCTTGCAATTAGGTGCCGATCGACATCGATCTCCGGTTTTAAGTACAGATAGCGATCGTTCCCTATAATTGGGTACCGATCAATTTCGATTCCTG
GTTTTGGGTACTGATCGCGATCGTCCCCTGCAATCGAGTACCGATCAACATCGATCTTCCATTTTGGGGGTATGTCGCATTTATTTCCTTCGAACCCTTC
GCGAACGTCATCAGGTCCTACCGCAGACATAGACTTTGGAGCTCCATTAACGGGGCTGATCTCATGGAATCTGCTTCACGCAGCTCGTACAACACTGATG
CGTAAATTGAGAAATCTTTGATGAATCGACTGTAGTAGTTGAGACTTCCCAAAAATGACTGCATCGATCGCAGCGTCCGAGGGAACGGGATGTTCACCAA
CGATCCCAAATCTGTCGTATTAGCTTCCAAACCTGCGAGCGAGATTTGATGTACTAGGTATTAAACCTTGCGACGTCCCCAGAAACTTTTGGCCAAACTG
ATCGACAAATACCACTTATCGCACGCCTCCAATAATTTCTCCACTTTCTCACACAGGGATTTCCACGACGTAGCTGATATCAATATGTCGTCGATATAGG
ATTTTTTCGACCCAACACCGATGGTTTCGGATCAGTATCTGGTTCACCATCGGTTAAAACATCGACTAACTTTGGTGATCCAAAGGATCTATTCGGATCT
TGCGCCGATTTTCAAATATTCATACAGAGCGTTATCAATCAATCGTTGGTAAATCTGTGGAGCGTTTTTCAACCCAAAAGGCATCCGCAACCCTCAAACA
ACCCTGACGGTGTGATATAAGAATAAATACCCCTTGCCCTTTCAGTTATTATCACCACCCAAAACCCACTCGCCATGTCTAGGGAGCAGTACCTCATGGC
TTTATCAATGTCCTGCAATAGTTCACTGATCATAGGCATAGGGTATACCATCAACCTAGCCAGCTGGTTCACCCTCCTGTAATCAATACACAGCCTTATA
GATTCTCCGTTTTTCTTGATGATAACCACTATAGGAGACGTCCATGGTGATGTAGATGGTCGGATGATCTTGGCCGACAGTAATCCTGAAATCAGATGGG
TGAGTTTCTCACGAAATTTGGGAGCCACAGACCTGACACTCTGCGCTACCGAGTTGGCCCACCCACATCTATATCGTAAACTTCCCACGCGCCGCAGATG
GTAGGGCATTACCTTTTCTAATCAGTAAATGGCGACTCATCCAAATCACTTGTCGGAACTTCTATTGATCATCAGTCCTTAGGACACCTGGATCACCCAC
TTGGATATTATCAATCGTTATTTTTTGCGTGGGCGTACCAACCTCGGGCAGAACTACCATATGCTGATCGACATCGTCAGCTGACAACTCGCCGCCATCT
TGGTAATA