Description :
From Genome Similarity Track
Location :
Scaffold_542:8274- 12073
Transcript NameFunction/comments
Phyke_g10146hypothetical protein PHYSODRAFT_545408
Phyke_g10147hypothetical protein PHYSODRAFT_301465

Sequence
3799 bases(100 bases per row)
TCTTCGAGAAGCGGGATGGGTCCACGGGTGAAATCAACAGCGCCCGTGCCTTCATCGAGTTCAAGCGCGAGGCAGACCCGTACCGGGACGTCAACGAGCG
GGTTCACGACTGGAACGAGATCAACTCGGGACGACGTGACCCCATTGAACGAAAGATCCAAGCGGCGCGCTGTATGGACTGCGGGACACCATTCTGCCAA
ACCAACACGGGATGTCCTGTAAACAACCTCATCCCGGAGTGGAACGAGCTCGTGTACCGTAACGAGTGGAAGGAGGCCATCGACCGACTGCACAAGACCA
ACAACTTCCCAGAGTTCACGGGACGGGTGTGTCCCGCTCCCTGTGAAGCGGGATGTGTTGCGGGACTCGTGGATGACCCCATTACTATCAAGAACAACGA
GTACGCCATTGTGGACCGCGCCTTCGAGGAAGGATGGATCGTGCCGCGGATCCCGCGTCGTAACGGGCTACGTGTGGCTGTGGTGGGATCGGGACCTGCA
GGATTGGCTGCTGCGGATCAATTGAACCAGAAAGGATATCATGTGACGGTGTACGAGCGTGAGGACCAGATTGGCGGATTGCTGACGTACGGGATCCCTA
ATATGAAGCTAGAAAAGCGCACGGTGACCCGTCGTGTGGATCTCCTCCGTGAAGAAGGCATTGAGTTCGTCACCAATGCCGAGATTGGTGTCAACACAgc
tgtggagaagcttcaggcTGAGAACGAcgcggtggtgctggcactAGGATCAACGGTGCCGCGCGACATTGACATCCCAGGGCGCCACCTGAAGGGTGTG
CACTTTGCAATGGAGTTCTTGACGAAGAACCAGAAGCGGTTGATGCTGACAGTGGACGGCAAGCTGCAGAGCGGCTGGGACCGCGACTTTGTGACTGCTG
AGGGTAGGGACGTTGTGGtcattggtggtggcgacaCGGGGACGGACTGCATTGCCACGTCCATGCGGCAGCGATGCAAGTCTGTGGTGAACCTGGAACA
CAACCCGCAGCCGCCGGCACAGCGTGCCCCGCACAACCCGTGGCCCGAGTACCCGCGGATCTACGGTGTGGACTATGGTCATGCTGAGGTACGCTCTGTG
TTCGGTGAGGACCCGCGGAAGTACAGCCGCATTACTAAGGAATTCAAGGGCAACGAGAACGGCGAGATCACGCACGTGGTTACACTGCTGAGCGAGAGGG
ACCCGGAGACCAATGTCATCACAGCTATCCCTGATAGTGAGGAGGAGATTCCGTGCGACTTGGTACTGTTTGCAATGGGCTTCTCACACCCAGAGCAGAA
GATCGCAGAGGCTATCGGTCTGGAAGTGGACCAGCGCCACAACATCCGCGCAGCTTATGGCAACTACCAGACGTCAGTGGAGGGCgtctttgctgctggc
gattGCCGCCGTGGACAATCTCTCGTGGTGTGGGCCATTAACGAGGGCCGTGGTGTTGCGGACTCTGTGGAGAAGTACTTCTTGCAGGAAGGCTTCCAAC
CAGAGGTCTCTCAGAACCAGCGCTTCGGTTAAGTGGCCTTGTTGACATGGCCTCGAAAGACAGTATGTACCGGTAGACAATCGTGCCGACGGCTAGCATC
AACATCTcaagtggaagcagcgcTTGGGAGTCATTCACACCCGCCTTACTTGGCGTTTCTCGACGACAGGATCCAGAGCTTTACGGAGTCGGCAAATAGC
GTAAGTGACTTGACGAATTGCGCGGCGAGAAGGGCGACGTACAAGATCGGAGGAAAGTGTTTattgcagcaggaggagcttATTCAATTAACGTATGACA
GGCAACATGAATGTTTGAAGTCTATTGGATCGATCTACTGGCGGATGATTGGTACGCGTGCTCGCAATTTTGCAATTCCGGTCTTCAAGgcgtcgctgtt
gttcttgttgtagCGCAGATCCAACACACGAACACCCGTGAGCATGCTCACGTCTGTTAGTTTGCAGCAGTCGGACAGGTTGAGCTCATGCACGTTTCTC
AGTGCCGAGACGTCTTCTAATTGTACGCAACCGGAGAGGTTAAGTGTGTGCACTCGGGCCAACGCGGAAACGTCTCGCACCTTCGGGCAATGGCGAAGCG
ACAGTGTGTGGACCGTCGCCAACGCCGATACGTCCTCGACGCTGGGACAGTAACTCAAATCCAGCTCATAAGCGTTGGTTAGAGGCGACACGTCCACCAA
CTTGATACAGCCTGCAAGCTTTGCGACGCGAGCACTTTGTGCAAGCGGACGTACATCCTCGAGCGAATCGCAGAAACGCAAGTCCACGTTCTGTGCTCCA
GCGAGATAGCGGACATCGCTGATGAGTGAGCACCCAGACAAATTAACCTTGGCCAGATGCTTTGCTGACTGCGCAAGCACCGTGATGTCCGCGAGCGATT
CACAGCGATAAGCCACAATGGTGTGGACTTCGCGCAGCGTCGAACCGAGGGACTGCAGCTTCTTACAAAAACTCACGTCGAGCTCACGTACGCACGTGAG
ACCATCGAGCGCCATCAATTGACTGCATCTTGACAGCACAAGTCGGTCGAGTGGCGGCAGATGTCGGAGCTCAGAGGATTCAAAGCCTATGCAGCTCGAC
AAGTCGAGGTCGCGAAGACTGGAACTCGCTCCCAGTGCGCTCAAATCTTTAACGGCGTCACACTGCCGTAACGAAAGCTCTCGAACCCCTTCACCTAGTG
CAGAGATGTCGCTCACGTATCGACATaatgcaagctgcagcttgggcaCACGTCCGAGTGCAGTCACGTCCGTGACGTTGATACAGCCCGTGAGGTCCAA
GTCCTGCACCTTCCCCAGCCTCGAAACATCAACGACACCCGAGCACTTGCGCAGTTTGAGGGTGTGTATGCTACCAAGGGCACTCACATCGGTCACGTTT
ACACAGCCCGAAAGGTTCAACTCAAGAACGTTGCCAGATCCCAACGCACTCACGTCCCTAACGTTCACACAGCCTCCAATATTCAACTCGTGCACGGTGT
TCAACATGCTCACATCGCTCAAGTCCGGGCAATTGCGCAAACTAACGCGGTGCACGAATCGCAACGGACTGACATCACTGATACCCCTGCACACGTTAAG
CTGCACGGAGTTACAATGTGCTAGCGGTGTGAGATCTGTGACTTGATGGCAATAGGATaaatccacgtgctgcgAGCCTTTTAAAAACGAGACGTCttcc
aagaagctgcagtagctTAGATCCACTTCATGAATGCCGGACAGCCAATGCAGACCTTCAATCTGGCTGCAGCCACTCAGCCCGAGTTCGCGTAAGTTAT
TCACCCCGTCGAACAACCGCACTCGTGCAATACCCGACAGGTTTAACCGCTGCACTGGACCATCGTCACCGTCGTGGATGAGATCTTGGAGTGCCATTGG
ACAGGCATAACGGGTTAGCAGACCCACTTCATCCGCGTCAGTGTACTCTTCATCGGTCGGCACAGGTTCCGGTGCTGGTTCGTTGCGTCCCAGATCAATA
ATATTCAGTCCGCCAGAAGCGTTCACGTTGTAGTGAATGTTCTCTTGCAGCCTGTCTTTGTCTGGGTGTTCATTGACAGGTTGAAATGCCACGTTGCGGA
GGTTGCGCCACTTGTCTAGAacacgctgcagctccgaaACGCTGCAGACCAGCGAGGCTTCGGTTTGAATCTGAATGCTTTTGTGCACGACGTCGTAGAA
ATAGCGACTCAATTCTGCCAGCGCCACCGCCTCGTTGAGCGTCAGGAAAGGGATCAAGTGCTCATTCCAGAGCTCGATAGGCATCATGTACTGAAGGTG