Description :
From Genome Similarity Track
Location :
Scaffold_713:827- 3575
Transcript NameFunction/comments
g15601.t1hypothetical protein

Sequence
2748 bases(100 bases per row)
TCATCTCCAGCTTGCATAGCCTGGAAACGGGCTCTTGCGCGCGCACCTTGGTTGAACTCGTATAATAGAGCACCACAGTTAAGCCTCGACACAGGTAACC
ATTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATGTCCGAGTTCTCTTAGTCCAGCGTAAATCTAGGATTCGCTCGAC
TTCATACTCGTCGTTCTCTACGTCAGGTTCCCAGCTGTCTTCTGGTAACAAGGCTGCGTCGAAATCGTCATCTTCCTCCACGTCTATTTCCACAGCGGGT
CGCTTTGGGAACAATGCTCTAGGCTTTAGTCGACTCACATGCACCCAGGGATTAACACGATATCCTGAGTTCTCAATCCTGAGTTTCACTCTGAAGTCGT
CGTGCATTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTTCGGCTGAGTCCGGGCTGCACCTTCGGTATATATAACCAGACAGCATCGCC
CACAGCGAAACCAGCTCTCAAACGTTCGGACAGTTCTTTCCATTTCCTGGTCTGCTCAGCAGAACGCATGCGTTTAGCTTTCTTTTGCAGGTCTTTGGCA
CAAGCCTGAGCGTAGCTGTAATCACGCTGCAACTTCCGACGCCAGTCATACGCAGTGCGTTCCTGGACGCTCGACGGCTTGGGTCCAAGCATAGCAGACA
CCGTACCGTGTGCGTCCCAGCCGTGCACCAGGAAGAAGGGGGTATCCAGTCTCGTTGCATCAAATGACGAATTGAGAGCGAACATCAGTCGCTCTGCATG
ATCATCCCAGTCACTCTGGTCGGCTTCTGCAACGTACGCGCGGATGCTTCGCACCACAGTCTGCACAGATCTCTCCTGCTGGCCGTTGGCTTGAGGACGA
TACGCCAGAGTGGCTCGCTGCTTGCTACCCAAGAGTTCCCGGAATCGCGTGAAGACCTCACTCATGAATCTTGGATCCTGGTCATGTCTTATCATAGAAC
TCGCTCCGAACCTCCTGAATACGCATTCTTCATAGACTTCAGCGACATCTTGGGCCGTCGTAGAACTCATGGGTTTACACATCACGAACCCCGAAAACAT
GTCCTGAAATAGGAGCAAAAAAGTGTTTCCGCGGTCCGACTTAGGCATGTGCGTCACGAAATCCATGGACACAACCTCGAACGGTCGTCTGGGCTCAATG
TTTCCAGGCGAAGGTCCAGGATTTGGAGGACGCCCCTTGCCGCTGGCGCAATCTACGCATTCCTTGACGAATTTCTCAACATCGGCATACATACCGGACC
AGTAGAATTCAGAACGAAGCTTCTCATACGTCCGCGTGATCCCTTGGTGTCCACCTTGGAAATCCTCATGTGCGTAGTGCAGCATATCTGAATGTAGACT
CCTTGGCACGACTAGTCTGAGTTCGTCGACCATGTCACGTGGGCGATCTCTGGTAGACCGACTCAGGCGGTAGATGACTTCCCGAGAGTCAAGCACGAAA
TCATCGGCGACTTTAGCAAGCTTCCTGGTTTGGGCGTGTGACATCTCTGTTACATCACCCTTCAGGAAATTCTTGAGTTGCATCAGGAAAGCGTCCTTGT
CTTGATGCAGCTTAATACGTCGCCATCGTTCCGCTTGGTACTCGATCGGGCCCATCACATCGCCTTGGTCTGGTTCATCCTGAGCTTGTGCACGAGTTAC
GGCAACAAGCACCTTGGCGGCCAGTGGCAGAGGTGCGGACTCTGGTCCAGGGAGATTTGTAGAATCAGCATCCTGGCCATTGTCGTCCTGCACTCCCGCA
TCCAGGATTTGAGCGGGTTTCATCAGCTTCTCGTGGATCTTGGACACCAATTGCAAGTGTGTCAGCTCGTCCTCGTCCTCAACCTTCCAAGACTCGTCAA
GCAGTAGCGTCTTAGATGTCAAGTAGTCTGCCGCCTGGTTGAATTCACGCTTAACGTGCACCAGTCTGACGGACTTGAATCTTGGTCTCAGAGCTTCATA
CTCGGCTAGTTTCCTTTGTAGGTTTGGTTGGTGACAATTGATCAAGCCTTGTGCTTGTTGGATGATGATCCTGGAATCACCGACCACAACGATCTCCTGG
ACGTCATGTTCTAACACCATGTTCAATCCCTTGAGCAGCCCACTGTATTCAGCATCATTCACGGTCACATCTTCCAAAACAAATCCTTGTGCATCTAGGA
CCTTCCATCCAGGGAGGCGCCACAGAATGCATCCGCAACTGCCACGGCGTGTAGACGTCTTGGCGGCACCGTCAAAACTCAGGATGTGGCCTTCAAAGTC
AGCACCCAACATCTCCAGACTAATGGGAATTATTGGTGCGACTCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAGGTGTG
ATTCCTGCATCTAGGATGGCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCT
TACCGTCTGCCGACTTGGATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTC
TAGGACTCGCATGATTGAAATCACTTCCTTCTCGGCGAGCTGGTATCTCAGCTCAGCGTCGTTCAGGACACGCCCCGTGAAACGAACCGGATGAATGACT
CCATCGTACTCTTGGCCTAGTACCGCAGACGCTGCCCACTGATTAGCA