Description :
From Genome Similarity Track
Location :
Scaffold_71:82690- 86844
Transcript NameFunction/comments
Physo_139186reverse transcriptase

Sequence
4154 bases(100 bases per row)
TGGATCGCCCCCGCGAGCAGTTCAATCCTCGTTGGGGCGCAGAATTACTCCTCGTCGGCCACATGGACCATTTGCAAACGTCGGTCGCTTCGCTTCCGGC
GTAGGTAATCGTACAGGAGGCCACCGCACGAGAGATTGGACGCTGGTTCCCATGTCGGCTTGTCATAGCCGACCCACTTCACCTTGAACTCTCGGACGGC
CCGGTGAGTGATCGTTGACAACGGTGACCGGTCATCGAGGATAGCCTCGACTTCATACTCGCCGCCCAGGCGGTCCGGCTCAAAACTGTCTTCAGGCAGT
AATTCCTCGTCGAAGTCAAGAGGAGTGTCTTCGGTGACCTCACGGGCCAAACGAACCCTCGGTCGGCCTTCGAACTCGTCCACTGACTTGAGTCGTAAAA
CATGCACCACCGGGTAGAACCGGTATCCACTTCGGTCGGGTAATTCCAACTCATACGCAAATTCGTCGACCTTCTTCTTCACGCGGAACGGTCCGTGCCA
CCGATGGGCTAGTTTCTTGGTCAGTCCTGGTCGAACCTGCTCCATGTACAGCCACACTCTGCTCCCGGGCTGCAAAGAAAACCTCGTTCTCGTCACTGCA
GCTATACTATGGTCAGGGGAACTCGGTGCCCGGTCGACCGAGGTTCTATTCTCGTTGACGCCTGCCATGGCTTCCTTCTCCTTCCTGCCAAGCGACTCTC
CGAGCCTTTTCCGCGGCTTGGTACTCCTTAGCTCGATTTCCTGCTGTCGGTTGACCTCTCAGCGCCATGCTAGCGCGTTAGTTTGGCTACCGAAGCCTCG
TTTGAGTGACGAGACATTGCCTTGAGCGTCGACTGTGCATCCCACCCATGAACGAGGTAAAACGGAGTTTCCTTCCTCGTCGTATCACGGGAGCTATTGA
TGGCGAAGATCAGTCTTTCGGCGATCTCGTCCCAATCCTACCGTAGTGGGTCTTCAGCGTATACGCGGACTGACTGCATGATCGTCTTCACCGATCTCTC
CTGCTGGCCGTTGGCCTGCGGGTGGTAGCTCAGGGTCGCTCTCGACCGAGACTGCATCATTTCCGCGAAGGCTTGGAAGATCTCGCTCATAAATCGAGGA
TCTCGGTCATGACGGATCAAGGACGGTGCTCCAAAACGTCGGTAGACACACTCCTCGAAAGCTTGCGCAACGAGTAAGGCGGTAGTGCCAGACATGGCTT
TGCCCATCACGAATCCCGTGAACGAGCATTGGAATAGCAGGAGAGCCTAGTTGCCACGGCGATTCTTCGATAGCGGTATCACGAAGTCCATAGAGACTAG
TTGGAAGGGTCTCTCGGCTAGGATGTTCCCTGGCGAGTACCCGCGGAACTGAGGTCGGCTCTTACTTGAACTGCAGTCAGGGCACGACTTAACGTGTTTC
TCCACATCGGCATACTGGCCGACCCAGTAATAGTCTCTCGCCGCTCGATGTAGCGTACGGGTAATACCTTGATGACCGCCTTCAAGTGAGTCATGACAGC
TTTGCAGGACCTCTTGGATCATCGTTGTGGGCACCACGAGTCTCATCTTCAACTCGGCCTGCTCGCCGTCACTTGAACGACTGCTCGTTCTTGTGTAATA
TTGTACATCGTCCTCGCTCAACACAAATTGGTCCGCCATTTTCCATGCATCTCGTGCTGCTCTGTATCCAATCTTCGCATCATCTCCCCGGAGCACTACC
TTCAGATTCGACCACCGTAACTCTTCATCTTGAGCGGAGGCGATTCTCCTTCGGCGTTCTTCCTGTACTACCAGCGGGTCAATGTCTTCTGCGTTCGGTG
GGCCTGGTGACGTCTCGGCACGCAGTGGTGAAGCTTCTGCTTCATTCTGAGACTCGTTCGGCACACCATTGGCTTCTACTCGGTGAGATACATCTCCCTG
ATCGGTGACCGAGACTTCATCTGCAAACTGGACGTGTTTCTCCTTTGCTCTCGTTTGACGTCTGGTCATCACAGCTACGTGTCCGGGTTCAGTCTCGTTC
TGCCGTCTGCGGTCGGTTTCTCTTCGCACAAAATCGAAAGAATTCTTGCTACGAGGTTTAGCAGAAGCTACCACGGCCCATACTTTGTTGGCCGAGGGTA
TGTCCTCGACGACGCACCCGTTAGCAGCCTCGTAGATGACTTCAGCGATACGGTTCTAATACTCGGTCGTCCGACGATACCACCGTAGACTCCTTGCACT
CGAGAGTCTCGCTTGCCAGACAGTCGACCGCAGCGTTAAACTTTCTCACCACATGCAGGTACTTCACCGACCGAAGCTTGGCCGTGAGTTCTTGGTGGTG
GCTGAGTTGTTGCAGCAATGACTCCTTCCGACAGGCTATCACCCCTAGGGCTTGCTGGATCGCGAGCCTCGAGTCGCCGACGACAACTAGATCGTCGGCT
CCATGCTGTAATGTAGCAGAGACGCCGTTGTTCATCCCGATGTACTCAGCGAGGTTGACCGTGGTGTTCTCGGGGTAAGCGCTCGCAGCAAGCACTACTG
TCCACTCTGGTAGTTTCCATAATATCCACGAGCAACTGCCGTATCCACCGTTCTTCTCGGTCTTCGCAGACCCGTCAAACGACATAACGAAGCCTCGGTA
GGACCGCCGTAGGCGTACGTAGAGCAGATGCGGGTCCAAACGAGCAGTTGGTGACCGTCGTGTCCGGGGTGTGACCAACGCCAGTGACTTATCCAAGTCA
ACAAAGTTCGTCAAGCCGGCTTGAAGTAGCTGAGCAAACGAACAGTCGGTTTCTTTGACTCGTTCGACCAACAGGTGCCACGGCGACAGCAAGACGCAAA
CTGGGTAGCCCGACCGAACAATGTCTTGGACTTGTGGACCCAGTCGAGTGTCGAAAACCGAGTGTAGACCCGGATTCGCTGTCCAACGAGTTGAGTATAA
CACACCTTCAGTATCAGCAGAAGCGCGAGGACCTCTTTCTCGGCCGGGTGATAATTCATCTTAGCATCCTTCAAAACACGTCCGCAGAAGCGAACGGGGT
GTAGTTTGCCCTCGTCCTCTTGCATCAACGTGAAACTTTGAGCCCACTCGTTGGCGAACAACATTTCCTTCTTCCGGTCGAAGTGTCGTAGTATCGGTGC
TGCCGAAACCTTCTGTTGGAGCATCGCGAAGCTGTGCTTAACCGCGGTGAGGTCACCCCCGGGCTGGAAGTCCTCGTCCTTAAGCTGGTACAGCGCTGCT
CCATAGATCGCGAAGTCTTGGATGAAGCGACTGAAATAGTTGAGTGCCCCAAGGAATGACTGCATTCCTTTCCTCGTTGACGGGAACGGAAGCTCGGCCA
CCCCAGCCAGCTTCTTAGCGTCCGGTCGGATACATTCTGCCGAGACTTCGTGGGACAGGAAGTCTACTTTGGACTGCACAAAGATGCTCTTCGTGAAGCT
GATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCGGTCTAGCGTCGCCAAGCACGACTCGAAAGTCTCGGCACCGAACCAGATATCATCCACGAAT
GACCGGCGACTGAATACTGGTGTCAACGAGGAGTCATCGGGCTCCCCGTTGGCGAACATGTCGGCGATAGGGCTGTTGACCAGTTCGGCTACAGCTCCCT
TACCAAGCGAGTTGTCTCGGTCGGCCTCGAACTTGGTCCGGAATGGCTTTGCCGTGCCAGTCGAAGCCTCGTTCACCCCAGCATGAGCTTCCTTGTCATG
TTCTTCGGCTAGACGCATGCGCACCGAGAATTTAAACCATCCTCCCGTCGGTTGGACGAAGCCCCAAAGCGCGTTGTCAATCATGTGTTGATAGATCATC
GGTGCGTTCTTCAGGCCGAAAGGCATACGCAACCATTCGAAGTGCCCCAGTGCGCAGACGAAAACAGAGATCTTCCGAGCTCGTTCGGTCATCATAATGG
CCCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAATCACAAGTACGCCTCCATGTCCGTCAGCAAGTCATCCACCAGGGGCATGGCGTACTCCATAATCTC
GTTGATCGCATTAACGAGTTTGTAGTCGATACACAGGCGGATATCCACCCCATTCTTCTTCAGGACGATGACGATTGCCGACGCCCATGGGCTGTCCGAG
AAGGAGATAAGCCCGGCCTTCAACAGACCCTTCAGCAATTCGTACAGCTTACCG