Description :
From Genome Similarity Track
Location :
contig_9:82681- 84269
Transcript NameFunction/comments
g2585.t1ETP06908.1 hypothetical protein F441_16766 [Phytophthora parasitica CJ01A1

Sequence
1588 bases(100 bases per row)
CTCAGTCGCCGCAGGAGTATGACGGCGGTGCTCTTCGGGAGGGAGGGGAGGTGAACATTTGGAGTCGTGAATACATCGGATTGGTCGCGCAGTACGCCGC
GGTGGGTATGATCTTCGGAACTCTGCCCGGCACAGTCTACCCGTTCCTCTTCAACTACCTCAACATGGAAGGCACGCAAGTCGTGTCGGCTGTGGTTCTG
CTCAACATGCCGTGGTCGTTCAAGATTTTTTACGGCATGATCACGGACTGCGTCCCTATTTGGGGGTATCGACGCCGTCCGTTCATGGTCATCGGATGGA
CCCTTTGTTTCGCGATGCTGCTTGTCATGGCCTGCATGGATGCCGGCGCTCCATACTTTCCGGACAACAAGTACGCGACGATGGATGAATCGGAGCTGAC
CCCTGAACTCGTTGCGACTTTCAACGACTCGGCACACCACGTGGGCGGCAAGTTTATCGTGCTTATGATGATCGCCGCCATCGGCTACGTCGGAGCCGAT
GTCGCTGCTGATGCCATGATGGTGGAAGTAGCTCAACGTGAACCGGAGTCTACGCGCGGATACACACAAACCACGATCTACATGATCCGCACGGCGTTTG
TGACCGTTTCCAGTATCCTCACTGGTTTGGCTTTCAATGGCAAAGACTACGGGGGTGACTTTGACTTCTCGCTGAGTTTTCCTCAGCTTATGGTTATTCT
CACTATCTGTTGTCTTCCAGTGATCCCTCTCTCGTGGTACTGCATCAAAGAGGAGCGCCATCCTGGCGTGATTTTCCGTGATTACATGGCTGAACTCTGG
CACCTCATCCAAACGCGCCCGGTGTACCAAGTCATCGCGTACAAATACTTGTCGGGCATTTTCGAGAACTTCACCATCACTTGTGCTGACCCCATGCAGT
CGTACTGGGCTGGGGCCACCCCACTCAATCAAAAGGTGATGGCCATCATCGGCAACGGCATCTTCGCCCTCACGCTTTACTTAACTGGTAGATATGGTCT
CCACTGGAACTGGCGATCAATGCACGCCATCACGATCGTCTCAGTCACCATCATGGACTTCATTGTAACGATGCTCACGACGTGGGACGTCCTACGCAAC
CAGTGGTTTTGGCTCGGAGTGCCCGTGGTGGAGAACCTTCCGAATGGCATCTCTTTCGTGATCGGAACGTACGTGATCGTGGAGCTGGCCGGTGAGGGTA
ACGAAGGTGCTGTGTACGGACTGGTGGGATCGATCTCCAACATCGCTATTCCCCTGGCCAGCACGCTGTCGAAGAACGTGGACAGCTACTTTGACGTGAC
CAACGCCGATATTGTCGAGGATTCGACCCATGTGCGCTGGGATGTGACGTACGTCCTCATCATCCGGTACGCTATGAACCTCGCGGGACTTGTCTTCCTG
CCGCTCCTCCCGCGCCAGAAGGCTGAGACGCAGCAGCTCAAGCAAAACGGTGGCTTCAGTCGCTTCATGGGAATCCTGACCTCCATCTACTTCGCGTTTT
CACTCTGCTGGACGGTCATGGTGAACATCATGTCCATCTACCCATCCACTTCATGCCTAGTAATTGCTGGTGGCACCGGCTGTGACTC