Description :
From Genome Similarity Track
Location :
Scaffold_362:8266- 10241
Transcript NameFunction/comments
Phypl_g7434ATP-binding Cassette (ABC) Superfamily

Sequence
1975 bases(100 bases per row)
CGACCTCGCCATCAGGAGATGCACGGGTTACTGCGAGCAAATGGACATTCACTCGGAATCTGCAACAATCCGAGAAGCGCTCGTTTTCTCGGCCATGCTA
CGACAGAGCACAAGCGTCCCGACCAAGGAAAAGATGGAGTCTGTAGATGAATGCATCACTTTGCTGGAGCTTGGCCCCATTGCCGACAAAATCATTCGCG
GGTCATCTAcggagcagatgaagcgtCTGACCATCGGCGTGGAGCTTGTTGCGCAGCCTAGCATCATCTTTATGGACGAACCCACGAGTGGGTTGGACGC
GCGTTCAGCTAAGCTCATCATGAACGGCGTCCGAAAGATTGCCAACTCTGGCCGAACGATTGTGTGTACGATCCACCAGCCGAGCTCCGAGGTGTTCAGT
TTCTTTGACTCCCTGCTGTTGCTTCGTCGGGGAGGACGCGTGGTGTTCTTCGGAGACCTCGGAAAAGACTCGAGCAACCTCATCAATTACTTTGAAGCTG
CGCCTGGAGTGAAGCCGATTGAACCTGGTTACAATCCGGCGACGTGGATGTTAGAGTGCattggtgctggtgttggtgctgcctcGGGTACTGGAATGGA
CTTTGCCGAGCACTTTGTGAAGAGCGACTTGAAGGCTCTGATGGACAAGGATCTAGACAAAGATGGAGTACTTCGGCCGTCAACAGAGCTCCCCGAGCTC
AAGTTTACGAAGCAGTTTGCGTCGACGGGGTTGATGCAGTTTGACCTTCTGTGCCGTCGATTCTTCCACATGTACTGGCGCACGCCAACGTACAACCTCa
cgcgcttgatgatcagtgtgctgcttggtgcAATCCTCGGCGTCATCTACCAGGCGACCGACTACACTACATTCAACGGTGCAAACGCAGGGGTTGGGCT
CGTTTTCATCAGCACTGTGTTCTTGGGAATCATCGGCTTCAACAGCGTCATGCCAGTAGCTGCGGACGAGCGAACTGCGTTCTATCGCGAACGAGCGTCC
GAGACGTATCATGCGCTCTGGTACTTCATCGCTGGTACGTTGGTCGAGATTCCGTACGTGCTGCTATCTGCCCTTGCCTTCACCATCATCTTCTACCCCA
GCGTTGGCTTTACCGGGTTCTCGACGTTTATCAACTACTGGCTGGTCGTGTCACTCAACGCGCTTCTTTTCGTCTACTTGGGCCAGCTCTTGGTGTTTGC
ACTGCCCAGTGTAGCCGTAGCATCAATTGCTGGAGCGTTGCTGAGTTCCATCTTCATGCTGTTCTCCGGGTTCAATCCCCCGGCGAATAACATTCCGACG
GGCTACAAGTGGATCTACTACATCTCGCCTCCGACGTACAGCATTGCAAGCCTTGTGGCAATGGTCTTTGCCGACTGCCCCGATGCAACCAGCGGCAACC
TCGGTTGCCAAGTTTTGAAGAATGCGCCGCCCACTGTGGGCAACATTACTCTCAAGCAGTACGTCGAGCTGGCCTTCAACATGAAATCCGACAACATTTC
CAGGAACATCCTTGTACTATGCATTCTCATCGTGGCGTTCCggctgctggcactgctgtCACTACGATACATCAGCCACCTCAAACGGtaaaaaaaacaa
aaaaacaTGGCCACTCCAGACCATGCTTTCGCTTAGCTCCTGTGTTTTTCTAGCTTCTTCGGGGCTTTCTTTCCAAGAACAGCCCCATCTGCGGCCGGTC
GAGCAGTCGGGTCCTGCTTCATCAACCATTCTTCCCGTGAGATCATCCAACGCACACCACTTGTTTGCACTAAGTATCCAACAGTCCACATTTGCGTGAA
AAGAACGAAATCGAGCCATGAGCGGGTCGCTGTATCTCAAGCCAAATGAAGGAGTTTTCCGAGTTTCCGCTTCGCAGTGGCAACAGCGTTCTTAATATTT
ATCTCAAACCTCCGGGTTGAGGGCATCTGGATaagagcaccacgaggaCAAGCTCTCCATCCGAATCTTCACAGG