Description :
From Genome Similarity Track
Location :
Scaffold_60:82649- 86391
Transcript NameFunction/comments
Phyci_229506Hypothetical protein
Phyci_9211Hypothetical protein

Sequence
3742 bases(100 bases per row)
CTGTAAGTCAATCATACCCTCGTACACATCGCACTTAGTAGAGGGTACACACAATAACTTTGGCGGCACCACAGCTCCAAGATACGGTATCGATATGGCC
GATCCGCATCGCAGTCGTTACGCCGCCACGCGGGGCGAGTTCAACTCGAGATGCCGCTCTCCGCCCGCCTGGAGACCGGACGTGCCTGAGCGATGGCGCT
CCTCCTCGGTCGATCGCCACCGCCGCTCTCCACGTCCCGGCGCCGGGGGGCGATACCCCGCGCGGTCCCAGTCGCCTCGACGTTGGGCTCGTCACCGAAA
CAACCGATCGCCATCGCCGCCGCCTCCAAGAGGAGACATGACTTCACGTCGCAGCAGGTCTCGATCTCGGTCGCCCCGCGCCAACTACACAGTTGAAACG
CCGGAGAAGCGTCGCCGCAGACTCTTGGCGGAGAAGGTCATGTCCATGAACACCTACCACCGACTGCTGCTGGACCCGTACTCGTCGTGGTCCAAGAAGG
CAAAAGGCACGTCGATGCCCATTCCGGTGCCGTTGGAGTCCAACGAAAATATGGGTGACTACCAACAGAAGTTCGAGTTCTGGCTAGCCCAGAGGAACGT
GACTCTGGCATCGCTCCGAGAAGATGTCATCCGAGAGCGCAACTACCGTTGCGGTTATGCTCAATGGCGCGTGCAAATGGGCTTCGGCCACACGGCTCCG
GCTTCGATATATGGGCCACAACGCGCGCGCTCGAGATCTCCGGTCCGGGTGAGACAAGAGCAGGAGAGCGAGCGGTACTTGTCGACTCGCCCCCGCAGTC
CTGTTAGATGTGGTGGCTACCAGGGAGTGACCCAGCGCTCGGTGTCAACGCCCAGGCCGTCGAGATTCTATGATGCACGTCGAGCCAGACGCTACGATGA
TGAAAAGACTGGAGCCTCGCATGGCTCCTGCAAAACCTGTGGTCGCGACTGGGCTGATTTCAACCGGCGTCTGACGCAGCTCGAAAATATCATTTCCCGA
CTTGATTTACCAACAGCAAACACATTTGGGGGTCACAGCTCTTCACCTTACGAGATTAGTGGTGATGCGGAGCAGCCCCGAGACGACTCGTCACGTACAT
CCAATTTCATAGATTTGACGGACGATTTTGAAGACGAGGTAGAAGCTGCGGAAAATGTTCGATCGGTAATGGGGGACAACTCGAACGGCAGTGCAACTCC
GGTGACAGGTGAGTCGCGAAGCGTTGAAATCACTCCCACAGATAGTGATACAAACCACGAGGGCCCGTCAACGGCCGGCGACTTGGATGAACCGACCTCG
GAGCCCGTGCATGAGTTTGAATCGAAGATGCCGCCCGGGTTGGGCCTTCTGATCGATACGTACAATCAAATTAACGACCAAGTTTTGTCCGAGCAGAAGG
AGGAAAAGAAAGTGGTAACAGCCATGAAGTCGATGACTGACGGAGAGGAGGCCTGTGGTGCGGATTTGCAAAGTCGAGTTTGCAAATTAAGCGAGTTGAT
TAAGCTGGAGAAAGAAAAGCGAGACGCCGCTGTTGCTGCAGTAATTGTTTGTGGCCTCGGCGATAAAAAAGCGGAGTTCGCTCGTGACGTAGAAAGCATG
GGTACGTCTGATGCGGCTAACGAGCAAGAAGACTTTCACGAGAAGTGCGCCGGCATTGCTGCAAAACTGGTGGAAAAAGAGAAAGAGCTTGCGCGATTAC
AGAAGCAGCTCCAGTCCGTTAGTTCGTTGGACGAGAGCGACAGTGCTCTAATGCAGCGAGAATCCCAGGATTTGTCTAGCAAGATCGCGCTGGAGAGAGC
TTCGAAGACATCGCTCGAAACTGAGCGCCAGAAGATTTTCACACGACTCATGAAGTCGAGTCGCAACATCCAGGCGCTTGTGGCGAAGGAGCTGTCGAGC
GAAGCTTAGCGGGTTGTGGTGAAGTACTGAGCTGCTGATTTCCCAGTTGAGCTGTCGTTTGTCAACACAGTGTCGATCTACGATCGCCATGATGAGTGTC
AGCATTCGTTTTAATCTGTGGCGGCTAACTGCTAGCGGATACAGTACTGCTGTCGACGGAGACTACCAGCGTTTTTGAACAAAATTGAACAAACTGAACA
AATGAAACTAGCTGAAATGAATTAACCACCCTACCTGAGCCTGGCGAGCCTGTACACGTAAAAGCTTCGGGCTTCTGTACCTGCAGCAGCTGTATCATAT
CGGAGCAAGTAAGGGGTCCTTTTGGAGTTGATGTTGCCTCGAAGCGGCCAGACGTACTTCTCCCACCCTTCCAAAGTTGCTAATAAAGTTTTAAGCGTCT
ACGACGCAGAATGTCGCCACCTTCGCGCTAGGCAAGCAACAAACTCTCTTGCGATGGGCAACTCGCTCCTGCAATGGGCAAGTTGCCCTCGTGATGATCC
GAAAAGTTCGTGCAGAAAAAGTCAAGGTCGTTTTTTTTCTCTGGCGTCCCACTTCGATTTCTACCGAAAATGGAGCAGCCGCCGCCAGGTCCGAAGCAAC
CGCCTGCAAGCTCCATGGGGTCTGCTCCGCACGCGAAGAGACCGCGGCGGAGGACAAGACGTGCCCCAAGTGCGGCAAAGTGACGCAGAGTCGTCTGGCG
CTGCGCCTCCACCTGAATCGCGTGTATCCGTGTGACGCGGAGAACTCGGCAGCTTCCACACCTGCCGCAAGTTCACCACGGCGGCCAGTCTCAGCCTGCA
CCTGCTGAAGGTCACTCCGTGCGACGCACCGGAGGCGACGCGCAGCGGCGCGTTCAAGTACGAGAACTTCTCGGAGAAGTGCAACGAGGTGTTTGCCTCG
GCGAGGAGTCTTTTCGCGCACCACAGCCGCGTTTACGCGTGCGACGACCCGACTCGCAAGAGGGTGTGGCAGGGCGGCCGAACGTGCCTCAAATGCAACA
CGACGTTCTGCAGCGGCCAGTTGCTGCGTCTTCATCTTAACCGAGTGGTTCCATGCGACGCTGAGAAGCCTTCAACCTCCGGCTACAGCGCCACTCTGAC
CGCTGCTGGGGAAGAGGGCGGAGAGAGTAAAGCGTCGGCTCGTCCAAAGGTGGACTTACGGCACGCGTGTCCGCAATGCCAGAGAACTTTTGCCACCCAG
CACGGATTTCACATCCATATGAGCCGGTGTCGGAAAAATCAGCTTAAGCTTACCAAGCCACAGTCCACCGAGGGAGACGGTCACGCTACGCCCAAGATTA
TGAAACAAAACGAAGGACAAAACCAAAACAACCTCGTGAAGAATGTGGTTCGAGTCGAGTATGTGGAGCCTACTACCAGATTCTGCCGACTCGAGGAAAC
ACGGTGTTGGTGTCCCTACAGTGCGCGATTGTGGGTCAGGTGGGAAGTTCGTTTGATGTGGAGATCGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN