Description :
From Genome Similarity Track
Location :
Scaffold_424:8264- 10480
Transcript NameFunction/comments
Phypl_g8169hypothetical protein PHYSODRAFT_491195

Sequence
2216 bases(100 bases per row)
CGGGAACGACGAAGCGTAGTGTAGTGAGCGCAGCGTGGCATCCTCAGACATCAACCCCAGAGCTTGTTCAAAGCTCAGATACAGAGGAGACATTCGTCGC
TTGTGGAACTTCGCCGACGCGCATTCTTGAAAGTGCGCCGCAAGTTGGtcggccgcctgctgctcgccgcaAAAACTGCAATACAAAGTCGCCTGCCGCT
CCATCGTCGAAACCGGCgacgccgaagccgaagcggaGGGGTGATACCCTAGGCTCTGGCGCACCACAGAACGATGCAGCTCCGACCCCTCTtcaatagc
agcagcagcaggctggGGCTGGTTCGAGCTCGAATTGTAATGACTCGGCCTGCAACAAAACACACACAAGACAGCATCAGCACCTGTCATCGCACCAGCC
ATCTCACAGTCGAACGCACTTCTTCCACGACGACTCGCGCGTGCGTCGGTTGTAGTAGTAGACCCGTCCTTTGGCCGTGTAGGCCTCCTGCCACTCGTCC
TCCTGACCATGTTCCTTCTCCAGTTTCTCTTCACCGTCCTCCTGCGTGTCCTCATGAACACCCTCACTGTCCTCTGCTTCCACCTGTTCCTCTCGActgt
cctcctccatctcctcctcctccgagtccgCCTGTCCTTCGGGCGTCCTCCACTCACGACTGTGCTGCCCATctccgtcgtccagcgtccACCTGTCCTC
CATCACCTCGTGCACAAAGTCCAGGTAGCCCCCGTCCGCCCTCCCGGGTCTCCACGGCCCTCCgtcctgctcttcctcgctctcctcgtcctctccgcCC
TCCCCGGagtcctccagcagccgcagagCCGCGCGCACACtcgcctccacgtcggcctcgtcctcctccgtcagTTCCTCGGAGCTGACGTGCATGCGTC
GATGCGcggccagcgtggccacgGGCGTGACCATCCagccgtcctcctcctctcccTCACTCTTGCGAGATGCCTCGGAGCCCCAGCTGCGCTGATCCAG
ggcgtcttcttgctctccTGTCTGCACCTGCGTCTCCTCTAGGCGTTCCATCGACTGCGAGGTCTCCAGCGGCTCTGGGTCCGGAGATATCGACGCAGAC
AGCGACGCATCAGGAGTGCGCGAGGTGTCCGCCATGTCCGATTTTGTATTGGCTCTTGGTAACGTAACAAATTTATGGAATGGACGAATCGTCCATTTTA
TGGACGTTCAAGCAACTTGCGAGCAACTTTACAGTTTACACCTAACTCACATATACCTGGTGGCGTAAATGTCAAGGTGTGCGAAGCGAAGTCTTCGCAC
ACCTTTCTCGACCAAGTTAGAACAGCTGACCATACCCCCAGATATCCAACCCTCCATAAGGATAaatagacagtctgatccCCCTAATTGCAGCGCTGTG
CTCGATCTCGCCTGCCAAGGCAGGCGAATTTGGCCGAATTTGGCCATTTAGACGGCATAGGGTTAATAGCCTGTCTTTATCGAAATAGTTTTTGGTGAAC
GTAGAGACTTCCTTTTGAACTTAGTCTGAACCTCGAAGTACGGAAATGCACGCACGTACTAATAATTATAATACCACGAATTGCCACGAATTGTCGCCGT
CTGGGGACAGCCTCACCGCGATTAATTGGGCTGGCGGAATGTCGTCTGATCATTTTACAACCTTCCCGTAACAAGTTCACTTCAGTTGATTTCACAAAGC
TAGCTACCCGTTTCTCATCTGAATAAGTCACTCCTCCAGCGTTCTTCGAGCTCGCGAAAGCGATTGACGAGCGTCTTCGAGCCATGTACTACCTTTCCAA
AATCTTCGGAGCATGTTGATCCTATTAGTGAAATGAAATGAAATTAGCGGTTATGTCGGCTGGCTACGCCCGGCGTCGCGCATtggtgcagcgccgcatA
CGGGACCCCGCGGTAGCAgcccaggagcagcaacactAATACTGTGATATAGTGATGACGCCCCGAAAAAGTAAACACATGCAATATCTAAACACTCNCG
CCGTGTTTGCCCGTGTGGTATCGCCGTCCTGCGCCTTGTAATAATCACTGTGCCTCGGACCCTGGTTCGTCGGACGCAACCAGTAGAATTTTTCCAGGCA
TCGCTCAGTTTCTTCGTTTCACTGTCCGCGCAGTGCGTCCTGCGCCTTGACGTGCCTCAATGGTCCGTGAAAGCCCTGATTCGTTTGACGCAACTGATCC
TATTAGTAAGTACGAT