Description :
From Genome Similarity Track
Location :
Scaffold_117:8263- 17253
Sequence
8990 bases(100 bases per row)
AAATTGGCGGACTGCATCATGATATTGATGTTTGAGTATGAACCGCGAGTAAAACAAGCAGAAAAAACGATTTTCGTTTTCAACGAACGGTCAATCAATC
AAAGTCATCATGGATATTTGAATCGCCTAAGAAAGGAATATGGGGCATGGATATTGATGGCTTTACTTGATGAAGTGAGCTTTATAATCACGATTTTGCA
TAATGTGTGAGTTTTCTTTCAAAAAACAAAGGTGGAATTTGTTGATCGATTTGCTTAATTCAAATATCACCGAATTACTGTTATCGAAGAATTTAGTGCT
TCAGAACTGACGACGGTGAAGAAAACGATGACAAAAGACTGTGAAATAAATGTGAAAAAGCAGAACGATATTACAAACGTGTGCTCTTACTTCCCACAAT
CAAAGACAACTCCCTAATGAATTAACATGAATAATATAGATATGGCGAGATCACAGCTCTCGTGCGTAGAGATAAGAATAGACGTTTGCTGAAGCCGTCA
TTACATTTTCATTTATCAATTGCAACTACGAGCACTTCATCCCGTTAGAGATCAAAACCACAATAATTTGATATTTAGCAATGAGCTAGAATTATGAAAC
TCTGAAACAGAAGCATAAATTGAGCTATGTATATCCAGATAGAAATTCGGTCAAGGTTTGAGGAGAAAGTCTGCTCATGCATACATCTTTGTTCCCTGGA
GATTCAAGGATTGTCGGATACTGAATATATATGAGTTGAAATATTTCAATTGACGAGATCAGCTAGTTTTGATAAGAAGGCAAAGATTCACAGTATGAAA
TTGTGTGAGCCGGGAAGTTTGGAAAATGAGCTAATCTTTTAAGCAATCCCTAGAGTCTTGAGACAGTAAACGTAGACAAAAATAGGCATGTAAGATGGTT
CCCTTAAGCGATAGATGTAGCCTTAAATCACCATAACCCGGAGGATGCAATAAGAATCACTTTTTGTGAAAACAAAGATAAGCAGGTGGACGAAGCGATG
AGTTTGTTAGAATGCCATTTTAGATTCAGACTCATGCTGCTAAAATTGCACCTTCTTGATGCGAAGATTCCAGACAGCTTGTGTTCCCTCGAAATTTATT
GAGCTTTTCAAAGGAGCAAAGTAGCATCAACATCTCACAATAAAGTCCTTTAACATATACAGCACTGGAAGCACGTAAAATGTACAATTTCGCGATTGAA
TGCTTTGAACTATCATTCCGATGACCTTAAACCAATAGGTATCGCCCTATAAAAAAGACTAGGAGGTCTCTTGATAGTTCCCGAAAGAGAATAAAATGGG
CATTTATTGGATTTTCTTTCTTTTCTACATTTAGAAGCAAAGCAAAGGCGGAAGTGTTTTACATGTCTTGTTTCACCCCATTCTGTTCATCTAGTTCGTT
TAAACAACAGGTACAGAATGTGCTTCAATAGAATCTCCCGCGCTTAGCCATTTTGTTTTTGAGCCTACATAGCGGAGTATGATATGTATGCGGCGTACTG
TGTATCTAAAAATTTAATGGAAGTTTTCATCTTTATTAGAAAAGGTTTTCAGTCAATATAAACAAAGTTGAATGCTAAGTCAAATTTTAGAATTGATAAC
GGTTGCAGAGACGTAATTAAAATCCCGTTTTTACATTTTTCCTCAGAGTGGACATTGAGCAGGGGAGATTTAAATCTCAATCACTTACCTTGGTTCGAAA
AAGAACGATCTCGTATTGCCGCTTGCAATTTTTTGTATCGATGATTGATATATATCAGATTCATGCTAAGGAAAAATTGTATTACGGAATTTAGCCGAAT
CATTTACATGATTCACTATATACTCATAATACCATCAGAAGGTGGCTTTAGAAGCGAGGGAGCGTGAGTCATAGTGCTTCAAACAGCGCTACAAATCACT
ACAGTAAAAGCGAGGAAAAGCTAACATTAGCTCAAATCTAGAAAGAACGCATTGATTGACATCTGCACTTTAAAAAACTCGCAAGAACCTAGATTGTTTA
AAATAATCGGAGCATACCAGACATCAAGAATCGCTTCAGGAATAGAAACGTATAAATTAAGTATTTACCGAGCAGAGACATGAGTTATGACGATTTTCAA
GAAATGATGCATGGATCGAGCATCCAGCTTGAAGTATGCTTTGGAAACAATCAAGCTGAAGCAAAATCAACATTTAAACCATTGGTGAATTAAACACAAA
TTTAAAACAAGGACTAAGGAGTAGCATACGAAAGTATGGAATCTTTAAAACCTTTCTCTTCATTTCCGAAAAACTTGCAAAGACATATCGTGTGCGAGAC
ATCAAAGCGTTTTATTTAGAACATCAAACTGAAGAACGTTCAAGAGAATCGATTCGAGTATTGCAACATTTCAAACAATAAAAACGAATAGAACGCTTTT
CAAATGCTAAAAGGACGTCTTCGGCTTTTGTGAATTGTGATGGTAATTGACCAAGCAAAAAAAAACGCTGAAATTTAGTTCTAGAATAACGATTATGGTA
ATGGATCATTGAAGTTGTCCAAGCCAAAGCTACATGTAAATATTGAACTTAATAAAACAAGACTAGAAATACTTTAATTTCCTGCATGTGTGCAAGTAAG
TGACAAAACATTTTTTTAAGGAAACCGAGTGCATTTGTCAAAATCGATAGTCTTTTTTAGCCATTCTTAGCTCGATGAAATTTGAAAAACACGATGTTCC
AACTTCCACGAGATACGGTGACAATCTTACAAATCAGCCTTCAATGAAGAAGACTATCGAATAACGACATATAAGAATGGGTTCTCGGGCTGATTTTCTA
TCCACCCAAGCTTGACAAGCTAATACCGAATATTATTCGGAGAAGCCAACATCAAGAATTCCAAGATGAGAACAAGTGTAAAAGGAAAATTTCGCTACAA
AATTGATGCATAACAAAGGCATGCAAGTACTCTTTCGTCCAAAAACATTCAAAATTTTACCGACGGATTGCTCATGTAGGTCGTTTCTGTTGTCGTCAAA
TTGGAGAGTGAATATACGTACAGGTCCTTAGTTCTCAATTAGATGACCTAAGCGCATACCATACTCTGATATCGCTTCTCTATACCATGATAAACATATT
TCTTATCTCGCATTTCCGCGCAACTAATGTTCTGATCTTATCCGATTCTTCTGATCGCAGGCTTTCTATAACAGTTTCTTTGATGTTCATTTTGAGAAGT
AATGGTCAGGTTTGGACAGCCAAAAAGCAAAAATGAGCTTGACTAAAATCTTTATATTTCCTGACTACAGACAGGCAGCCGTAAATTCTCACAACTACAA
CACACTACTTCGAACGACGCTGTTCCAAGTGTAAGTGTCGACTCATTCGACCGACCAAAAAAGCAACCCCTGGATTGACTTCCTTTAAAAACGTAGAGGA
GTGAGCCTAACACAGCTAGAAATACTGCATAATTAGAAAATCTCTACTTTACTTCAATTTCCGATCAAATTGGGCTTCGATCTATGGACATTGAAATGTC
TTTGCGTCGGGCTGATTTTATTTTAGCACCATTGGTTGGAAGGTAGAAGCTTGAAAGATCTATATTGAGTTCGTCATGATCATAATTAACTCACTTTTCC
AGTATGTGTAATTTTTCGAAATCCTGTAACTTGAATTGCACCACTGAGCTCTGAAAAATCTCATGTATATCCCCATAAATGCCCAGGCACTCAACGAAGG
TCAAAACGCATTACGCGACGTATACTACCGAATTGTATTTTCGCGAGCAATCCGTGAGTCTGTTCGCTAGTGCTCAAATGCATTTCTCTAAAATCACTTG
CGCTGTTAGCGCAAGCCAGGTTGCTAACGCCTGTTCCAAACCATTTAAGCGAGAGTTCGGATGTCCAAGAACATAAGGCCGAAACTTAGCAACTCTGCGA
CTCTCTGTCTCTCCGAAATGCGTTTTTGTTAGCACATTGCTAAATGTGATAGCTGAATCGCAACAAGGCGTTCGTAGGCCATATTTCTAGTTCACCTTAG
CAATTGGTGCAGATGCCGACACATTGTCATCTTCATATTCCCATGCTTCTTGATACTGACAAAAAGTCCAGCGAAGGGCACATATTCAATCAACTTCAAT
TCCCTTCAGACTGAAAACTCGCTTTGTTAAAATTGTCCTTCGTGTTCCGTTTTAGCATCTCGCTTCATAATTCGTTGATGCTGAGCTCTATAAGTGATTG
ACAAATGTCCTGGTTCCATTCAATTGAATTTGGAGATCTCGTTGCCGTGTTAAGTTGTACGTCGGTGATCTTTTCAAAGCTTGAATGGTATCTTCGTGTT
CGATAGAAGATGACTTTTGCTCGGATTGCTAAAAATCGATTAAGTTTCGTGTGGTATATAATGATGGTTTTGCACTTTCTGGCAGGTTGTGTGTAATAGA
TTTATGTCGAACATCATTGAAAATATTATGTCTCCTCATGCTCAATGTTTCAATTTGTTTTGACATCCCTGTTTATACTATCTTTACTTGTAAGCGGATC
CCGTACATCACAGCTTCCTTTTTTTCACAGCCTTACCACCACCCTGCTATGTTTTAAGCATGTGAAATTCATCACAGCTTTCGTTTATTCTAGAATTTAA
CCGTTATATCAAAATTCATCTTCGAACAGATAAAACATATTTCGACCATTTAAGTATTTCGAACGCGGTTGGAGGTATTGATTGTATAAGAAGAAAAGAA
ACTATTTCTTACACCTCGCTTATCATTTATCCCTAACTGACCCACAGAAATACCTTTGAACTTTTTCTGTCAATTTGCACGTATTGGATTAGATACAAAA
AATCCGAATGAAACGTATTTTGGCGATCCAGGTCTCCTGCAGAATATTGTCACCTGTAGTGAGCAAATACCATTTTGAAATCGATATATATAAAAAATCA
AAATCACGAAAGCGCTTACTATACTCAACGACACCCGATCGCAATGACTGTGGCGACACGCATTCTCTTGAACAGCCAGCAGAAGAGTGCGCGGCGACAG
TATCACGTAGCGCACCAGGACATGTCGCGCCAAGAGTTTAGTGAATGGGCAGCGTCTGCATTCAAGCTGCCATGTTCACTCGCCCGAGTGTCACTGATTG
ACCTGCTGAGGCGCCAAGAAGACGACACCGAGCGTAACCCGCTGCAAAAGGCAAGTCACTGCGCGCAGTCACCTGTGTTGGAAGCGCAGTTAGTGGTGTG
AATCAACAGGTGCGAGGAAGTGAAGATCCCCATCGTCACAGGAGCAGCCATTCGGTAGAAAGCAGAGATGATGCTCTATGCTCTTAACTACAGCCACCCT
AACCACTGCTGCTGTGCTTTCAAAGTTGATGTTCTCAAAAGGCTGGCTCTTGCAATTTCAACCGCGGCAAGAACTCAAATCCAGGCGAAGCTGGCTCGGT
CAAGACTACTGCAATTGAGAATGAACGCCGCGTGCTATAAGCAGTTACAAGCCTGTAGGAAAAGTACGATATCTACAATATGGACGAAACTGCGTACTTA
TATTGCTCGATTCCCGGCAAAACCATCTCGAAAAACCGTATCCCCTGCCGGAAGAAGATAAAGAAGTGCATCACCTTTGCAGTGACGAGCAACGCCTACG
GCTCAACCAAGATCCCGCTCTTCTTCTTTGGTACGGCTCGGCAGCCGTGATGCTTCGGAAGAGTGCGGCAGTGCTCGGTATTCAAGATGCAACTCCAGCA
AACGGGTGGATGAATACTGAGCTCGTTACGAACTGGATTGTACGTTACAACGAGAGAATAAAGATCGAAAGGCGCCATGTCCTTTTCCTACTGGACAACG
TCTCCTCTCATCGCGTTACTGCGCCGCTCTCTAAGGCCACGGTGTTAATGCTGCCCCCCAACACGACGTCTTTTCTCCAGCCACAGGACGCAGGGATGAT
TCAGTCGTTAAAGAGGTAATTAGAGCAGCTGAAGACCCGGTACATTGTGGGTAAGTTTGAAGAGCTGCTTGATAAAGCCGCAGAGGTAGAAAATGGAAAT
ATTTAGACGCAGATAGTCTCTTTGAATACCGTAGACGTCCTTCAGGCGATGCAGTGGGCTCAAGAAGCAAATTAGTCAGTAGTGTTGAAAACGGTTGCAA
GTAGTGTTGCCTTGGGAGGTAGCATGATTCTCTCAACCGGGTCATCTACTGGTGGCACGAGTGTTGGGATGATGCTTTCGGTAGGTAGTAGTGCGTCTAG
AAACAGCGGCAATGTCAATATTTTGGGTGGCTCTACTACCGATTCTGCTGGCAAGGGAGGTGTCATTTCTTTGACCAGTTGATCGTGTGACGAGCACCAC
ATTGGCAAATTGCTGGCGCCATACAAAGATTATCGACGGCAAAGTGTATGAACTCGTTGAGAGCAGTAAAGCAGCTTGCTTCAGGACACTAGCCTCACCA
CACTGCCGATAGATACACTAACTCTTATTCAGCATTAGTTACCTTTTATAATCAATACCAGTATCTTTCTAACAGCCTTCTATACTTGATATATTTTTAC
ACCATTTTTAGTGACGATATTCTGAAGGAGTACTGTACTTGGTCTGTGTCTTTGCCCTATTCAAAACTATCCTTTCAAGTGTTTTACTTCACATGTGGAA
TCCTCTATCAGTTATGCTAACAGCAGTCTATCGAGCTCCTTCACAAAAACTTTCGTATACGCTGTTCTGTTTCATGACTGGTTCGTTCACCCCGATAAAC
ACCTCCCGCAGTAGGTATGGATTAAATGTCACTGCCAATAATGGGTATAGTTCCGCAGCAAAACTTGACAGCAATTACTTCATCCTTGTTCGAAGTTGAA
TAGAATAATGTAAAGTACCCATGGATCAACAATCTCAACTGCACTTCACAATTCGATCTATTTGAGAAGCATGAAGAGTTTTAAACAATATCTGATAAAG
CGTCATGATACCTTTCTGTTCCTTGAAATTTACTCAGAAAATGCCAATAACTTCCTTGTGAACCTTGTTTATAGCGATAATCTCCTCTTATTCATGTGAT
AACCCGCAGCCGATCAATTTATGTTGCCTAGTTTATGCTGCAATTATTCTCAAAGCATGCCTGATTTCGAAGTTACAGTATGTCCGAAGAAGGAATTTGT
CATTTATCTCAATTTGCTTACCAAATATTACAATAACGTTGGCTGCAAAACGAATGGAGTAAAATTGAATGTATTCATTTTTGGCAGATTCTTCGCTGGG
TTTTGCAACTTTAATTGCTTCACATTAGATTGTTCTAAGCTATCCTCTGCGATAACTTTCTATTTTGCTTTTATCGCCTCATTACTTTACGTCTTTTCTA
GAAGAAAGACAAACACAATTTAATACAGAATTGAAACGTGCAAAACACTTTTAAATATACTAATGTCTTCGTTGCATGTCGCGTAGAAATCGTCTGGAAT
TTTACGGATTTCAACACGCTTCTACAAGAAGCTGGTATTGGTATGTGTTTCTTTGATCTTTCAAAGTCAGAAAAAATCGCTTGCATTTCACCAGATCTGG
TGCCTAACGTCATTTGCCGAAACTGCAACATCTCGAAACTTCATAAATTGAAATTAAACGATGTGCGATTTCGCTGTAAGCTTAGTTCAATTTTATGATA
AAGCACTTCCTCATTTGTGCTCATACTGTGCACCAAAATTGTCTCACATTAGCTCATTGCATGCCATTAAGCTCCAGCATTCTGTATTTACCTCTTCTGA
GCTCTCATCACCATAATACTTTTTCGAAATTGATATCCCAAACTCGAAAGGACCACCCAATCTGAAAAATGCATTTCTAATGTATTCTTTAGCTGGTCTT
GCTTGTCTGATCCAAATATTTCAAATTGTCAGAAGACCCAGCCGTTGCTCTTCCGACGCAACGGCGATTCTATTTGCTTGTATGACGTATGTTTTATATC
GGACCTGAGAATACATTGCCATCGTTTCTCATCTTATTTCTCAGTATTCTCTTTGTGATGTTGCTGTGGAAGGGTCTTTGCAAGGAATTTCTTGAAATAG
AACCACCTTGAACAGTTATACTACCTGTATTTGATAGATTAGATTTAGGCCAACTTATGAATGTACTTATCGCGAATGCCGAGTTGCCTTTAAATTTATT
GCTTTACTACAGAGATGTCACCCTTGTTCGAGGCTTATCACATCATCAATGCTTATAAGAACCTGAGATATAAAACCATTGAATATGGTTGCTGATATCT
TTCCTAACGTTACTTCAACTCGACTAATATTTCTAAGCTCAACTGGGTATTTTCCTACAAATAACTTGCTCGTGGTGTCTCTCATGCATCTAATTCCGTA
TTTGCATCTAAATCATCGAACGGATGTTCCACTCGACGATTTCAAGATGGTTGCAAATGCTATATTTGTTGTTGTTCTCGATAACTTTTTCTTGCTCATG
ATTTGTTGGTGCGTTATTTCCTCGATAAGATGAGATTATTATATAAAAGTGGCAGTAGTCGAACATCATATTGACATATTGAAGTTTTACGTGTACTTCG
TGATGTTTGCACTCGGAGGCTCTTGGTTCACCAAAAGTGGTGATTTGAAATATATCTGCAGTCGAGTGAAAATGAAATCCTAATCATATGAAAGTATTTA
ATCTTCAGTCAAAAATGGAAAGATTAATTCATATGGATAATTGCTACGACTTTAAGCTCGTAAAATGCCGAAAAAAATCGATTACATGGACAGTTATCAA
CTGTTCAGCTTGCAGGGGTAGAATGAGATGAATGAAGCAAATACCACGGCGAACCAGAGAACTTCATCAGATTTTGTGTGTGTGATGAGGAAGGCCCCGA
TTATCCAAACCTGAAAAATTTGGCAAAGTTTAGCGCTTAACACGGCAGTAACGAAGTAGACTACTATGTCGATCTGCATGCAAGTAGTGCAATGACTCAG
TGATAGACAATTTAAGTTTGAAGCTCAGATTTCTTAAGAAGTCCTTTCGACTCAGACAAACTACAATCGTTCTCGTAAAGACTCAAAGTA