Description :
From Genome Similarity Track
Location :
Scaffold_77:82619- 83749
Transcript NameFunction/comments
Phyke_g3263hypothetical protein PHYSODRAFT_558872

Sequence
1130 bases(100 bases per row)
TCGCAATCGACCgagagaagaaaaaatgcaCCAGCGGGAGGCAGGGAAGGACTCTCAGCAGCTAAACGTAGCTGCCGGTGGCGAGGAATtacgtgaagaa
gatgcacTGGCTGCGACGCAGATCGGGATGACAGCGACTCGCAGCAAACTGGAGAAACTCATGAACGGCTTCACCAAGTTTGACGACGTTATGCGCATCG
GCACGCGGGTGAGAGTCGCTACATTTGCGTGGCTCACTAATCGCTGAGGGATGCTAACTGCTCGGTGTATGTGCGTTGGATTGATGTCTACTATatgcag
caacgtcgtgaGAAAGACGAGTATCGTCTAGCTGAAATGCGGCAAGAAATGAGTCGCCTGGAGCACAAACTGGAGGCAGAGATCAAGAAGCGTATCGAGA
TGAACAAATCACTGCAGAACTACTGCGACGAGCAGGTGGCACAGATGACGATAGCGTTCGAGACGCTGCTAAGTGACCGCGCTAAGCAAGTAAACGACCG
ACTGACGCACTTGACACAAGAAATCAACGATCTGCAAGTGCTGGTGGCGAAAGAGAAGCACGACATCCCGCTCATGATCGAAAACAAGACAAACGAACTC
ACTCAGAAACTCATCTCCTTCATGGACTCTTTCGAGGAAGAACGCCAGCGACGCGCAACGCAAGAGGCGATGATTCTAAAGCGCCTGAGTGATCATGAGC
ATGCGACCGCAGAGTCATTTGAGCGCGAACGGGTAAAACATTTCCCTGTGGTGAGGTAGGAAACGTTGTTTGTTGCTGACTTGCAGATTACATTTCTGTG
TGTGTATAGCACGACCGTGAGCACAAATACtcggagctcaagaacgcACTCGACACGTATACTTCTACGCGAATACGTGGAGACGAGAAGTTCCACGCGT
TTGTGCAGGAGGAGACCGCCAAGATTCAGAATGCTTTGGTGGCAGAAGCGCAGGTAAAAGTTTCGCTGATACACTATTCGGATCTCAAGTGATATCTAAT
GTATTTCGTTGTTTGTGTTTTACTGAAGGCCCGTGAGCGCGAAGATGATGAGATTGTGGAAGCGCTCAACCGCTACACCGCCAAGCTCCAAGATAGCCTC
AAAGTCATCACGAGTCCGGATGCATAGGCA