Description :
From Genome Similarity Track
Location :
Scaffold_965:8261- 10475
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_965-snap-gene-0.5Ankyrin repeat protein

Sequence
2214 bases(100 bases per row)
ACACAGGCAATGCGTCCAGTTTCATGGGGCTCGTGCTGCTCCTGGTGGCGTGTTCCGAGCCCCGGTGGGCCCACGACACGGTCAACTCGGTGGATCTCGG
CCTCTGGTTTCTCGCGGTGCGTGTCCGCGGTCTATGGCGGGGAAACCAATGAGTCGCAGCGTATGTGACCCTGGGCGGCTCTGTGGATAGGGCACGGGCG
TCCAGTACAAGCTCATCAACGCCGGTCTCTCACCCGACGACGCGGCGGTCGCCGGCGATCAGCAGCCATTCACCGGCTATGGCCGGTTCTGGTGCGAGTT
CACGTGGAGAAACTCATAGGTAGTATTCTCACGTTGAGATCTTCTGTCTGTCTGTGCCAGTTCCATCGCGGGTGTTAGTGAGCGCGATCCGTGGTGCCAG
ACGTACGCGACGGCCGTGCGCGCGCTGACGGTCGTTGCGCTCATGGCGGCGGTCACCGGCTTCACTCACGAGCGTCATGGCCTCGCTCTCCATCAAGACG
CCGACGTGGGACGGCGAAGGCAGGGAAACGACGCTCGTCCTGCCGNNNNNNNNNNACGAGTTCACGTGGGGAAATTCATAGGTAATATTCTCATACTGTG
ATCTTCTGTCTGTCTGTGCCANNNNNNNNNNTATCAAGACACCGACGTGGGACGGCGAAGGCATGGAAACGACGCTCGTCCTGCCGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGTGTCTCTGCGTGCTCGCGGCCGTCGTGCTGTGGCAACTGATGGTGAACGAGTA
CGACACGGCGTGTCGTATCGCCATGCGCGTAGAGGACTTCGCGTGCATCTCGTCGACGTCGTCCCACAAAGTCGCCATGGCCGACGTGGTCTTTGCGCTG
GCGACGTACGTGCTCTGGCGCACGACCCATGCTTACCACGCACGTATTGTCCCGATGTCTATTACAACGGCGATTACATCGTTCTGACAGATGAGTCGCT
TTCCTTGTAGGTAGCTCGTCGAGACTCGCGCATCGCCGACGGCTTCACACTCGCGGCCAAGACAGGTGCGATTCAAAGGCACTCATGAGGCGACAGATCA
TCCTAATGGCTTCCTGTAGACAATGTGGACGAGATTCTGTCGGCCATCGCCAACAAGATCGATATGGACGCACTCGGCTCCGACGGCCGCAACGCGCTCC
ACTGGGCCTGCACGTTGAACCGCTCGAGCATTTGCCACGTGCTGCTCAAGAAGGGCGCATCCATCAGCAAGAAGGACGTACGTGATATCGTTCTTTCTGC
CTAATGCGTCACTTCTTCTCATATATCGATTGAAAGCATACAGCGAGATGGCTGGACAGCTCTCCACTGGGCGAGCCGCGTGGGCAGTCTCGATCTCGTG
CGGCTGCTGGCAAAGTACGGCGCCGACCTCAACGTGCAAGATCGATGGGGGACGACGCCGCTCATGCTCACGGTCGTCGGCGAGTCACGTGCAGCCGCAG
CGACGCTGATCGAGCTCGGCGCGAATATCAACGCCCGCAATGTGCGTAAAGAGCCTCACGACTCACCTGGAGGAAGCCGACTCTAACGCACATTGCTCAT
AGGTCTTTGGACAGACCTGCTTGATGGTGTGTCTCGAGAGCGGACTGCATCTGCACCAGCTCGGCATGCTCTTTCTCAATGCGGGTGCCGATGTGACGCT
TCAAGATGTAAGTTACTTTGACAACACCGCGCCATTCGACGTATGGCTGGGTGGTAGTGGGACCCGCACGGGATTTTCTTTCTGTTCGCCTGTGTGACTC
ATCTCACCTCTGTCTCTTGCTAAAGATTCACGGGATGACTGCTCTCCACTATGCCGCCGCAAATGGCCATGCGAGTCTCCTACTGAGCCTGCTCCCGCTC
TGCGACAGCCAGCTGATCGCCAAGCGCAACAAGGTACCGTTCGGACAGTGCATGGCTTGTCGATTCAATGGATTCATTTCATACACTGAATGCTTGTCTA
TTTCTGGGACTGGGTTCTGATGGATTCGTTTGGTACTGCAGTTCGGCGAGACGCTGCAAGACCTCGCACGGCTCCGCGGTCACGTGGGGCTCACGACACT
AGTCGACGATTGGCAGCAAGGCCTCCCCATCGTGGCGGAGCGAGACCGCCTCAATGTGGACGCCCTGGAGGAGGCAGATAGCACACATGACAGCGACAGC
GACGCCAGCAGCGA