Description :
From Genome Similarity Track
Location :
Scaffold_932:8260- 12436
Transcript NameFunction/comments
Phyag_g8762conserved hypothetical protein

Sequence
4176 bases(100 bases per row)
TGGCGAGTCTTAGTGTGAGTCAGGATGACCGCTTCGTGtgcgcggcggcggtgaGCGGAGAGATTCGGGTGTTTTTGGCGTCCACGCTACAGCAGTATCT
GAAACAATCGACGGAGCAGCACTCGTTCGCGATCACCGGCATGAGTTTTGCACCGTCCGCGGACAAACAGGCACCTATTTGCCATTTGGTGAGTGGTGGC
GCTGACAAGAACTTGCTGCGTCATGATATCCCTCTGGAAGGTGGCATTGTCAAGTCGGGGATGGAGATTGTTGTTGGCGGATTGAAGAACGCAGTGAGCG
CCGCTGTCGGGTTGGGGCTGAACCTCTGGATGGCCGCAACGCTGCTATTTATTCTCCTGCTATTTATTCATGCCGAGAgtgcaatgctgctggatggccC
GCTAGCAGGCTTCAAGGTAAGTCCGAGTGGCGATCCGAAGCACTGAGTTAGTAGGAGCTCATTGGACTTTATTTCTATCATGCACAGGATTTGGCATCGC
TTAGCTTGGATTCGTCGGATGGATTGGTGACTATTGGCGCTCTTGCGGCCAGTACCGTCGTCACGTGGCTCGTTTCGGCGCACAGTTCCGTGACGAACCG
CTTCTTCTGGAACGGTCTACTATGCCTACTTTCGGGCTTTGTAGCCTTTTCGGTGGCCATTTCGGCGGATCTGGAGGTCAACTGGCAAACTGGCGATGCA
GCCATTGACGAGTTGCTCGGTACGTCCATGTTGAGATTGTCGCGTTTGACATGTGTCGTGCTGATTTATGCGGGGTGGGTGATACTTCTGTACAGAGTAC
AAGATCGCAATTCTCCTTGGCGCGTGCTGTAttgcgttcttcttctgccattcgctgctggtgctcatgCTGTGAGTTTAGTACAAGGTGCACCTGGTCA
AAAACGTCGTTGGTagaaaagcagcaagcaaAGCGCATTCTTGCTGCTATGTTTCCGTAGACCATTTGATCGCAGTTTTGCTTGGAGTAACGGAAGCAAT
AAGAGGCATCAAGCGTGCTCCTAGAAATGAGCGACACAACAACAATTCAACTAGCAAAGGATGCGTTCATCGTATCAGTGAACATGACTGTTTAACCACA
ATTCCAGGTCATGGAAAACGGTTGCCTCCCTGCAGCTGGATTACCATAATTACAAAGGCACTCAACTCAATGGTTTCCCAGCATCTGCCGCTATCGCATG
TTTGTAAGCAGACGCCTATTTCGCGAAAACAGTTTTGTCAGTCTTTCCATCGCAGCATTCACAGTCAGCAGTAAAAGTTTTACAGCAGGCTCAGCAGATG
GGTCGCACGTTGTGATGGCTAGCTGGAACAAGTGGCGAAATGCCTCTGCACCCAAGAAAGCAAGGCTCCAAGAGGCCTGATGGCCGTAAAAATCATTGAC
GTGTGCGTTGAGCAGGTGGATCAGACCTTCAGACAATGGGGCAGCTCGATCTCTACCAAGTTCGAGTTCGAACGACAAAGTCCATTTCTCAATTGAACCA
TGCTGGTTCgggctgctgccatcgctaCCACTGCGCTCGCTGCTTCGCAGTACCTTGTCAGCCTTACTGcggcaacagcttcatctaCTGATGGTGGGTT
CACAACGGGGGCTTGGAGACCACTGGACCCATCCAACTACAAGATCAAGTCTTCGTGtgaacaccagcagtggaATTTCACGCAGGACTCGGCCAGTTCC
ATGTGGCTCCATTTTAAGTCGGTTGACCTCGCTTCCGGTGCCCACCTCACCGTCTCCTCATTGAACGGGTCGAGAGCTCTTTCCAttccatcgtcgtctt
caggtgTCACCACTACGCCAATTTCCGACAACGGACTCGTAGTGCAGTTTGTACCTCCTAGTCAAGGATGCACAGCAGACAACAATTCGACCATGGTCTT
GAACTCGGTCGGGTACTCGTACTCCGTCGACGATTTACAGGTGGACAATGAAGAACGCGAAATCTGCGGCTCTACTGATACCATGAAGAACCTGGCGTGT
TTCGCATCGGGTAGTgacgaggacaagaccaTGATTGCCAAGGCCAAAGCCGTCATGCGAACGCAGCGAACTCGAGACGATAATAAGATCGTCACCTGTA
CAGCGTGGCTCTGGGGCAACCAGGGTCACATCATTTCGAACAACCACTGTTTCTCCAGCCAGGAGATGGTCGACGCTGCCAagttcgagttcgacgtgCA
GACTGTCGGGTGCAACGACGACTGCACGTTTGCTACTTGCCCCAtcggcaagacgctggctGGTAAAGACAATGTCAAGTTCATCAAGTCCGACGCGAAC
CTAGACTACTCCGTACTGCAGATCACGAACGATGCGGCTTCGTACGTGAACGTCTACGGATACCTGCAGGCCCGAAGCACCGCTCCAaccgaagaggagg
agatttATATCCCTCAACAACCGAAGGGTGGGGCGAAGAAGATCACTAAAACCGACAACGACGCTGACACCAAAATTGCCACCGTACTCAAACTCGACTA
TTCGGTCGACGTAGAAGGAATCACCTATAGCCACCTCATCGCCTACGCTGCTGACACGGACGAGGGAAGTTCCGGCTCACCCGTTATCTCTCGAAAAGAC
AATTTGGTGGTGGGTCTGCACCGCATTGGAGACTGTGACAACGCCGCTACTCCATCGAACCAGCTCACCGGTGCTCTCCAAGCCATCGTCTCcgacaacg
acggcatcAAAACTGCTTGATAAATGTGTAGACTGTTCGTGTGTAtgtgtgcgtgtgtgtgaGTGAATCCTAATGCCACCAATTCGGTTCCCATCTCCAA
TCCATTGAATTTCAATGTGCCACCAAATGATAATCCAATAATGATCCTCGCCCGAATAATAGCCGACTGCGACTACAGACCTAAGTATGTGGAACAGTTC
TACCACTTGATAAAGCGAGAGGCGGCTCCAATGAATCGACATATCATCATCCATCGCCGCCAAGCACACCAGCAAACGTCGTGACGTCCAGTGGCCGATA
GTCAAGTTTCGCGAAGACTATCAGCAAAACCAACATGATCAAATGAGGAGATTTCAGGATTGCACTTACCCAGTAGTTTAGGTCGAGAGAGACCACTTCG
TTTCTTGTAGAGGCCTATTCGTGAACATTTCCCGTAATATCAAACAGCCCTAAGCGTGAATTAATCTCGCGATTTTATCTGCTAATGCCCGGCTCGGAAC
GGAAGGATGCCACGAAAACGCTTCGTTAAAAGCCGTAATATTTCGTATCGGTGGCTCGCGCCGCATTATTTCGTACACCTCCGGTGCTTTGTGAACTTTC
ATTACGTACAAAGCACAATCTCGCAACTTTTCAAAACGTCCGCAGTCGATGAAGCTATCTGGATTGAATAACTCTGATACAGTGGTGGAATTACCGAGAT
AGATCGGTATACTCCCTGCAAGAAAAGGGTTCACGAGCTTCTCCGTCACGTAACCTGGTACTCCTGAGTTCTCGAATGCGATGACAAATTTGTAGTTTTG
GAAAATCGTAACCGCGTTATCGTTGTACCATGTTGAAAACCGTGAAGACAAGTACGACAAGTCGGGAGGCCTGGAAGATCCAGCACATATTCCTAAAGCG
TCAACAGATTCCATGGCGTTTAAAATGTTAAACATGTATTCACGCTGGGGTCGATCACAACGAGCGTACAAGTAAGCACAAAATCGTCGCTCTTGGTGCT
TGTGAGGTTGTGTCGCTGGCGAGAGTAAGAAAGTGGGCTGGTGTTCCAAACGTTCGCCAAACGACGTGCTTGCTACACTGATGTGTGCGTGCTTGCCTCG
AGCGACGTTGGATACTGTTGACAACAAAATAACGCGTTCATCCAGCCCTTGAGTATCGGTAGGTTCACCGGCAATCATCATAATAGCCGTCGAATGGGCC
TCCTCATCAGGAAGATAATACTCATTGATGCACTCTGCAATCGCCTGTTGACATGTTGGCTTGGTTACTGGATTACAGTCAACATCCACGATAGAGAATA
CGAAGACGTCAGGCGCAGTCTCGTAATGCTTATACAAGACCCATTCCGGCATAACCAAAATCGGACGTTTGCGGTCCTCATAAACTGAAACGAACAGGCA
CTCAAGCACGATAGACACAAAATCAGCATGATTTGAGTACGCAATTATTAGCGGCGAGGCTTCGAGGTCAGCGACA