Description :
From Genome Similarity Track
Location :
Scaffold_388:8260- 10494
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_388-snap-gene-0.17Proly 4-hydroxylase

Sequence
2234 bases(100 bases per row)
CGTAATTGGCGTCCGCTTGATCGACCATGCGTCCCAGTTCGCCATTGGCATGGCCACCAAGACCAAGACCAAGACCAAGGCGAAGGCGGCGGCATCTCCG
ACCGCTCGCAGCCCCAGCAATGCGTCCTCGCGCGCCTTCTCGTCCTGGCGGATGCTGTTCGTGGCGCTGCCTGCGGCCATAGCGGCGCTGGGCGGCGTCT
GGCGCAGCAACAGCTACTTCAACGATGACTTGCCGCGCGTCGACCCCAGGGCCGTGAATGGGACGCCGCCGCTCATGAACGCGTCGATGGCGGCGCGCAA
GTTCCAGGCATGGATCGGCGACAAGCACGCGAGCGAGCTGGTGGATCTCACGACCCCAAAGCTGTTGGTTCCGGCGGAAGACGGCCGCGAATGTCCATCG
TTCAAAGTCGAAGGCGACCTCACCCACATCTCGGACGTGATGGGCGGCTCGGTGCCTGAGAACCAAGTGTTCTTGATGCTAAACGGACAGAACGAAGGCT
TGTTCGTGCCGTGGGAGCCCAACACCGAGTGCTTGTTCGAACTCGCACGGTTCGCGGCCGAACTGCTCGGCGTGGACGTCGACCTGATCCCCAATGGTCT
CAAGCTCTTCTCGCAAGACGGACTTCCCATCACTACAAGTACGCAGCTGAGTGAGCTCAAGATCGCGCACGTCTTGCTGGACGGACAGTTCTGGGTCTGG
CCGGGCATCGTCGTCGGCTACAAGCGCGACATCGAAGGGTTCAACGTCACGACGCAGTCTCTTAGCCCGAGGGTGTTCACGATCGAGGGGTTCTTCTCGC
AGGAGGAAGCGGACGCGGTCATATCAGAAGGCGTCGGCCTGCTCTCGCGTTCCCCCGTCGACAGCGTGGATGCAGTGGATGGCTACCACTCGGACCGCAC
GAGCTTCACGACGTTCCTGGAGGACTCGCAGTTCACGCGTGACATGCGGACACGCACAGCGCGTGTCTTGCGGTTGCCGGCCCCCGGTTTCGTGGAGCGT
CTGCAGCTCGTGCGGTACGAGGTCGGCCAGTTCTTTCGAAAGCACGAAGACTACTTTCACAGCAAGGAGTTTTTGCCTCCGAATGAGCTTTCGGCCAAAG
AGTACGAGGCGTGGACAAAGTGGGCGAGTGCGCAGATCGAAGCGCTTGATGAACAAGCAGCTCAGGATCTGCCGGTCGAGTTTCGAAAGGGAGGGGCTAT
GTTCCCAGACTTTAAAGACACGACCACGTTCCAACAGGCGTTGCTGACTGCCTTCATGGATGACGCCAAGGCCGTCAACTTCTTTGAGGAGCACACGGAT
GTTGAATGGGGTTCGTGGATCACCCAGAACTTGGAGATCAAGGCGAATGACATCATTGATCCGCTGATGAAGTCCAAAGGGTACATGCTGCCATACATCA
TCGAGTCGTGGGAGAAGCGGGCCGGAAACATCCCGCAGCTCAAGTACAGCATCCCTAGGCGACCGGTGAACGGCGTGACGCACTACTTTCGCTGGATCCG
CTGGGCCAAAGAGCGCATCCAAGACGTGCTGGACACGAACCCGTCGCTCGTGCCGGACGCCGTGGCCCCCACTGGACCGGACTACCCGACATACTACATG
AGCTTCCAGAACCGGCTGGTGTCCATGATCCTCGCGGACAACAGCAAGGACAAGCTGGTCGCGCAGTTCAATGCCGAGTGGTACGACTGGTTCACGGCCA
ACCGCGACAACAATGACGTGTTGCTCGAGGCTCTGAGATCTAGAACTGACGTCCTCGACCTCATTGTCGCCGCGTGGACCAAGCGTGCGGGCGACGCTAC
GTTCGCGTACACCAAACCGAAGCACCTGCACCACATTGAGCCGAATCGGTTTGCGACGCTCTTCTTGTACCTGAACGACTGTCTCGAAGGCGGCGAGACG
GTGTTTCCGTACTCGAAGGAGCGGCTCTTGACGGACATCAAGCGCGACGGGATGGCCGAGTGCTCGGACGGACTCGCCATACCGCCCATCAAGCTCACGA
CCTCGATGTTTTACTCGCAGACGCCAACGAATGACCTCGACCCGGCCAGTCTGCACGGCGGCTGTCCTCCGTCCAAGGGCGTCAAGTGTAAGTAGATGTC
TGGTGGGGTGTGCTGCACTCGGAGGTGCTCACTACTGACGTTGACGCTTGTCTTGCAGACGGCGCCAACTCGTTCACGTGGAACGTTGATGCCGACGAAG
GCGCCAACGCGTGGGACAAGGGCTACGACTACAA