Description :
From Genome Similarity Track
Location :
Scaffold_217:8259- 10629
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_217-fgenesh-gene-0.1Mitochondrial Carrier (MC) Family
Pytir_DAOMBR486maker-pir_contig_217-snap-gene-0.21Conserved gene of unknown function

Sequence
2370 bases(100 bases per row)
GCATTTTAGATTCAAGCGACACAGGCACACACACACACACAAGATGGCGACCGCGACAGCAACGAAGAATGCCAGCAGCGCACAGGAGGCTGCACCGCTC
CAGGTGGCCGCACCCGTGATCGCGTCGCAATACGCGCGCTTCTTGGCCGGCGGGCTGGCGTCCGCGACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGACTGCACGAAAGTGCGACTGCAGGCGCAGCGCGTCGTGTCGGCTCCGGCGGCGGCGACGGCGATGCTCTCGACGAATGTCGGCATGGTCT
CGACTGCGACGACGGCAGCGCGGCAAGAGGTGCAATACACGGGCATGGTCGACGCGGTGCGGACGATCGTGAAGGAAGAGGGCCCCGGCGCTCTCTGGAA
AGGCGCAACCCCGGCGCTCCTGCGTCAGGTGTCGTACACGAGCATCTGCATGGTGCTCTACGAGCCGCTGCGCGATTTCTTTGGCGCGAACAACGCCAAC
AAGAGCGAAGTGCCATTCGTGAATCGTTTCCTCGCCGGCGGCTTTGCCGGTGCGATCGGAATCACTGTCGCAAACCCGTAAGTGTTTGCATTTCTATTCT
GTATGTGTCTGTGTGTGTGAATGTGGTCATGTTGTTGTGCCACGCGTCGTTTTGTTGAGCTGTTCGTCACTCATCTTTGTATCTCTCTGTGGTCGACTAT
CGATCTGATTATGATATGCCAACAGAGTGGATGTCATTAAAGTACGCATGCAGGCAGACCGCTCGGGCACGCTCTACCGCGGTGTTGGCGACGCGCTGAC
CAAGATCTACCAGCGTGAGGGCATGCGCGGCTTTCTGAGGGTATGTTGCTACCGCTATTGTTGAAATATATTATTGCTTTACCATGACGCATGCACTAAA
CGCTATCCACATGTATCATCACAATGCAGGGCATGCCGCCGAACATCCAGCGCGGCTTCATCGTGAACGCGGCCGAGCTCGGCACGTACGACCACAGCAA
GGAGTGGCTGATCACGTCAGGTTTGCTATCGGATGGCGTGTTTGCGCACACGGGCGCGAGTTGCGTTGCGGGCTTTGCCGGCGCCGCGGCGTCCAATCCG
ATCGACGTGATCAAGACGCGCCTGATGAGCCAGCCGACCGACGCCACGGGCAAGGGCTCGCTGTATGCCGGCATGGGCGACTGCGCCAAGAAGACGTTCC
AGGAAGGAGGTGTGCAGGCCTTTTACAAGGGCTTCATTCCCAACTGGATGCGCAAGGCGCCGTGGTGCGTCATCTTCTTCGTCACCTACGAGCAGTACCG
CGCGGCGCTCTTTGACCAGGAGGAGTGAGGTGCTGTGTGTTGATAATTATATAACATGACGAAAAAACAAAGAGAATGAAACTGTTCATATCCCGCTGCT
ATTGTTGCGCAATTATCACGCATTTTCAGTCGAGAAATGAATAGGCGGCGATGCAAATGACTTGGCATGTTGCTGGAGATGAGGGTATTCTAATGTGGAT
AGAGCAAACAGCCGCGAATGTCTAACAATGATGAAATGGTGTCATTTAAATACTGTTTACTTCACACACGGTGCTTGCTTTCTAACCAAGCAGGTGGCGC
GTGGCTAAGAGAGGACGAGATAGCCTGCTAACTGCATACTACTTACTAGGCATCCCTTGGGTTCTCTTCAATATGCTAAAATGGGAAGAAAATAAAAGAC
AAATAATTAACAATGCAACGCTTCAAAGTCCCGCATCTGGATGCACCACGTGGAGCGCGGCGGTGTCAAGTAGCAGACGTGGTCCTTGAGCTCGTTCTGC
ATCTTTTGCTCCATCTGCTCGCTCAGGTCGATGTACTCGGCCGTGTGCATGACATTGAGCTTTGGGTTGTCCGCGGGCGACGAGATCTTGCCGTCCTTGG
GCAGCAGCACGATCGGTAGCCGCTCTGTCTCCTCCTTCGCCCACCGGTCGCGCGAGATCACGTGCACGCTGTAGCGCGAGAACGAGCCGTTCATCATGCG
GTTCGAAATCGTGCTCTCCACCGACGGCGTGGGTGACTCATCGTCGTCATCGTCGTCGTCGTAGCAAAAGTATGCGGGCCGTCGGCGGCGACCGCTCTCG
GTCGTGCTGCTACCTTTCGAGAGTAGTAAGTGGCGGAATTGCTCACGTTCGCGCCTCCGGGATTCCAGGATCTCTTCACGGGAGCACGCGCGGCTCTGGG
TGTTGCTGTGTGGCTGCTGGTGCATGTTAACGGTCGTGTTCGCTGCGGTGTTCGCGTGGATCACGTGAGAGCCCATGTTCACCGGTGCCACTTGGCTCAG
TCGATTGCCTTCCATGTTCATCAAGAGCTTCTGAAGTGCGAGAAACGTCTCGTCGATCTCGTCGTCCTCA