Description :
From Genome Similarity Track
Location :
Scaffold_43:82584- 87015
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.71Tubulin-specific chaperone D

Sequence
4431 bases(100 bases per row)
TAGTAGCCTGCCTCTTTCACCAAATTTTGATACGACTCTGCCCTAGATGCATCAACAGAGTGTGGCGTTCCcTCATCGTTCGCTTGGCTACAACAAAaCG
AAaTAAGATGAGTACGGcGCGAGAGTAAGTATGAAGTCGAAGGCATCGCGTACATCTtCTTTTgTGGGATCTCCATTCCTAAGTGCTTCAGAATCTCGTT
CCTGGCCCGTCTCGCGTCGTTGAGCTACATTGATGCAGTACGAAATTAGTGAAGTCACACCCAATTGAAATATCCTTCAGCTCTTACTGGGCCGTCCCAT
GCTGTTCCACTTAGTATATCGACGATGGTATCATACTGAGCATGACATGTCAGATAgtGATCACATGGCAGGAaGAAaTCGAACAACTCACTTtGTCTTC
AGCGATGACTTCTTCGTGCACAAGCAATCTCGTGTAGAGCTTCTCAGCAGTATGCTTCCGCACTTTAGGAAAGCGATGAGCCAGGAaCAGCACCAGCGCC
TTcAGGGCCTTAGTTTCCGTGTGTTCCTCACTTGGTAAGAGGCCGACAAGAACGTTGACAGCTGCGGCGAGTTTGGGAATGGCACTCGTCTTTGCGATcT
CATCTTTtAGCGCCGTGTACAAGCGCTCGCCGAACTCTGTGATCTGAGAATCTTCGTCCTTCTTCTGGAaCAAAAaGGCCAGCATCTCGtCTTCTAGAAG
CATTGATAGCGTCTTCATGAGCGGTACAGTTACTCGGTCGTCTTGAGCGTGTCGCTTGAACAGCGCTACGAGGTAGAACGAGAAGCGACTGAGTAACCCA
AAGTTCTTTACCGCGACATGTGATCGAATCCAaTTGAACAAGGCACTTTTTGATGCCTTCACCACACTTTCTGTCAGTCCTCCCACACTGATGACCAAAC
cTGACGCGGCTGACTCCATATAGTCGGGAATGTCCATCAGTCGTACAACAAGTGGgAATGTGTCGTGAGCCATCGACCAGTTGATCGCTAAAGTGATGGG
CAGAATCTGCTTCTCCAACTGGAACCGGTCtGGgATGCCGTCAACACGAGGATTTTGTGAGTGAAGAAGACTGAACAACACGGTGCCTGCAACAACTCGA
ATGTTGTCGAGTTTCTCTGCGAGCTGCTTGACGAGTGCGCATATCTATCCAAAGAAACGTGAGTACGTCTACACCAAAAAGCCTGAATGGTTACTCACCA
CCGAGGCTATCATGGTTACAGGAAGACGTCGACTGAACGAAGGAGGCGACGACTGGAAGCTTGAAGGTGGAGACAGACGATCTTGGTGCGCCGGAAGCAT
GAACGGTACGGATTCGGAGCCAACAGCTTTCACCACCTCTAAACGTCGGAAGGGAaTCAACCCAACTCCATGTGGTGCGAAGTAGAAaTAGCCGAGTGAT
GGCTTTTGGAATGCCACGCGACACAACACATCTGGGGCCCgCGCGTCGTTTTCGGTGGTGTGGTTTCCCCCGAGTACATGCTGAATGATACCAGCACCAA
ACGCCGTCCTTACCGATAACCCAGAATATTTCAATTGAAGCGCTTCTGACGCGAAGGGTACATCCAGCAACAGCTTCTGGAGCCCCAGCATGGCTTCTTT
TCGCACCCATGACCCAACGTCTCCGCGTTCATCAACTCCATAGTCCTCATAAaTGCACTGCACTAGTGTGTGAACCACTTGTTCTTCAAGTACTTCATCT
TCTGGGCTCAAGACCAGACAGTCAGCTCTTAGCCTCGAACAAATGTCTACGAGAGCCTGGATTGCAGCGACACGGCTTTCAGCATCTTGTTCTTCGGGTG
TTTGCTGTGAGATGCTCGCAACCACTATAAGTGTTCGAATGACGTTTGGTAGGGATGGCTGGAGGAGTTCCTTTGACGACACCCCTACAGCCCGGGTGTA
GCCGCGACGAGCAGCGACGTTAGGATTCAACGTCACGTTATCTCCTTTGTCGGCAGTTTTCGCAAGAATACCATTCTTGATAAAACGAGGCACTAAGTCG
TCGAGGAATTTCCGCACTGCAGGTGTTCCTTTTTCAAATAGTCGGGGGCAATACTGTTGAGTAAATGAAGCATAGGCGTCGATTGCAGAAACTCGAACCT
GTTCGACTGGGTGAATGAGGCACTCCTCGAGAACACTGAGGTAAACCTTGACGCTGCTGAAACTCAGGCTAAAGCCAGCTAAGGATATAACCTGGATTAA
CTCGCAAACAGCACTTCTAATTGTCTCACCACCTCGACCACGAAACAGTCGTTTTTTCtCAATCTCAGGTGGAAGAAGCTTGATTTTCGCTTGCAACTCG
CCGTCGATCTGAGATGGAGTTAAAATGAGAGATTGCAGTACCTGGCTTAACGCAAGCGTAGCACCATGTCGGGCAGTCACTTCGATATCCCCCGATAGAG
CCTGATTTAGTAGTCTCGGCAATACATACGACATTGCATATGGGGgATCAAGAGCTGCAATCTTTCCTGTTGCTTGAGCAGCGAGGACTCGGATCGACTG
GTCCCAGTGGACAATCTTCTTCGAAATCAAATGGTCGAGAAGAGCGTATCGATACTCGGGGTACTTCGCAATAAAAACACTGACATCCGAAAACGCATGA
CGCAAATTGGCAACGCTGAAATAGTCAGCCTTCGTTAGGAGATCAATACCGTTCGGGAAATTATTCCGACCCTGACGTCCCACATTCTCTTGGAATGCTG
CTGAAGCCGCACGACGACAGTTGAGCTCACGATCAAACACGCAGTTTATGAGCATCGCAGGAGCCAAAGTCTTCTCTAGGTGAGGAAGTAGCAACAAAGG
TTCGTATGCGCGAGCAAACGACCAACATGCATAGCAAGCAGCATCTCGAACATGGGCTCCAATGCTGTGCGCCCCTCGACGAATATCGTACTGGAGTGCA
CGAGCGACGCAATCAACGGCTTCTGTCAGCCGCTGGGGAAGTAAAACACCGCGACGAGCCAGCTCGGCCAGCGCAAGACTGGCACCGTGCCAAGCTCCCT
CGCCCTCGGTTGCAACAAATAGCTCGAGCACCGACTGAACAACATCATCCGCGTATTCAAAAGGCAGGCGACCTGTGATGCGTCCGATCCCCTTGGCAGC
CGACCAGCGAACGACGGTGTCTTTGTCTCTTAGACCGCAAAGGAGCACATCAACAATTTGTTCTAGCTCCTCTACGGTATCAAACAcAACAGCCTCGTCG
TCTGCTTTATGGGCAAATGGTTGTGATTGACTGGGTATAGAACCAGATGAAGCTTGTCCTGCCTGCTTCATGTTCATTTCCAATGAACGAAGGCCACGTT
GGTAGCgCCATGGCTGCACCCGAGGGGgCAGATACAATAATCCAAGGCGTTGGACGAGCTTGACACTCAATTTtCGATGCAGTGTACTGCTTGTTTGTGG
TGACCGCTCATCATCAGTCAACGTCGCGATAAGCTGCATGACACTACCGAAGTACATTTGGCTGGCTTTGATAtGTTTGTCTCGGGGTGAGTGTTTGGCG
ATGTACGCGAGGGATCTCATGATGCCAGTGATCTTGAACTGTTGCTGAAGTCGCCAAGTATTTGACTGATGCTGAATGGACTCGGCCGCCGTATGCAACT
CGGAGTCAGCCCACCCCAGGAATTTCTCCAGGTGGTGTGCTTCCATGTCTGGACGGCTCAACAGACGTGCGAGGCACACAGACGCAGCCAGTTGCGTCGC
TCCAGCATCCGCCAAGTAGCTCTTGCACAGTGTGAGAATGTTGGACACGAGAGAGCTCGTAGCAGAGGAgTCGATGGTGTTGAGATCGAAAGGCACGAGG
CAGAGCATCGACAGCCAGAGCAGCAGCACATATCGCGTCTCCCACGCACTGTGGTCCGATCGGTCTTGCGACTGAAGCATGAGCAGCGTCGGTTCAAAAT
CACTGACTTCGTGTGGCAGTAGTTTGACAACAGTCTTGTAGCCGCGCACTTTGCATAGCTGGTATACGAGCTGGAACAGGGCGTGGAGCTTGGGGTTCCG
GTAGATCTGAAAGGGGAAagCGACGCCACCCGAcTCTTCGAGCGCCTCCTGTCGCTCACGTGCGACGCCTGCGATGATGCTCTGGATCTCTGAGAGCACA
GGCGCGAGAAGCTCCCGCAAGAACGGATCCAACAAATGTGACTGCTCCATGTACCGATCGAGCTGATCAAGTTGGGAGAAGCACAACAGCTTATCAGCCA
GCCAGCCACAaCGAAAAcACCCGTCAATCCACGTACGATCGTCACAACGGTCTtGTGCTTGAGCTTAAACGCGTCATCGATATCGCTCTCGGGCGCTGGG
AACTTCGTGCAGACCAGTTCTCGCAGCAGCGTTACGACCTGATCCCGTTCCACGAaGAACTTGCGCTGGTTGCACGCCTCCTCGGCGTCGTCATCCCCCG
CGTCTGCCTCCATGGGCTCTCCCTGCGCCTC